Acrobasis normella

Dyar, 1908 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records9

Data sources6

Biological traits0

DNA specimens4

eDNA detections0

Sources6 archives

Databases and archives Acrobasis normella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF9 records

DNA & barcodingBOLD4 specimens

01Narrative

Acrobasis normella is a species of snout moth in the genus Acrobasis. It was described by Harrison Gray Dyar Jr. in 1908, and is known from Ontario, Canada, and central and eastern United States. The larvae feed on Corylus americana and Corylus cornuta.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis normella has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.51%

Haplotypes1

BIN1

Where individuals differ — all 5 variable positions, in barcode order

200Avariable

235Cvariable

277Cvariable

505Cvariable

613Cvariable

AACTTTATATTTTATTTTAGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTACTCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis sylviellasame genus1.7%Acrobasis betulivorellasame genus1.7%Acrobasis caryivorellasame genus1.8%Acrobasis betulellasame genus2.1%Acrobasis cunulaesame genus2.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type9 records

Wild obs. + sensor1

Museum / vouchered8

Range

Area of Occupancy AOO16 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 7

7 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	5
New Haven, US	2
Washington, US	1

3 institutions · 8 of 8 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)