Acrobasis betulella

Hulst, 1890 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records70

Data sources7

Biological traits0

DNA specimens22

eDNA detections33

Sources7 archives

Databases and archives Acrobasis betulella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility70 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF70 records

Environmental DNA1 datasets · 1 countries33 detections

DNA & barcodingBOLD22 specimens

01Narrative

Acrobasis betulella, the birch tubemaker, is a species of snout moth in the genus Acrobasis. It was described by George Duryea Hulst in 1890, and is known from southeastern Canada and the United States. There is one generation per year. The larvae feed on Betula species, including Betula populifolia and Betula papyrifera. The species overwinters in the larval stage. Young larvae probably bore into unfolding buds. Older larvae draw several leaves together with silk and consume the margins of the leaves. Pupation takes place in a pupal chamber which is made at the end of the tube.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis betulella has left across the world's sequence archives.

At a glance

DNA specimens22

BINs2

Marker genes1

eDNA detections33

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

38Gmostly conserved

266Cmostly conserved

460Cmostly conserved

AACTTTATATTTTATTTTAGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTACTCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.19%

Haplotypes4

BINs2

Most divergent pair1.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis ostryellasame genus1.5%Acrobasis carpinivorellasame genus1.5%Acrobasis irrubriellasame genus1.5%Acrobasis rubrifasciellasame genus1.5%Acrobasis sylviellasame genus1.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type70 records

Wild obs. + sensor13

Museum / vouchered57

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 6≤1 km 6

12 georeferenced · 1 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤1 km 18≤10 km 11

29 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence57

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	17
New Haven, US	11
St. Paul, US	8
Research Collection of Daniel Handfieldlocation not on record	4
Vernal, US	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Toronto, CA	3
Royal Saskatchewan Museumlocation not on record	3
Georgia Museum of Natural Historylocation not on record	1

9 institutions · 53 of 57 vouchered records shown · 4 without an institution code

09Environmental DNA33 detections

Where the DNA of Acrobasis betulella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map1 country0

Temperate mixed forestVerger Mixte

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.6 °C 17.2–20.2

Seasonal swing summer↔winter33.5 °C

Max temp (day)24.5 °C 22.1–25.7

Min temp (night)15.2 °C 13.6–16.0

Precipitation95.1 mm/mo 84.6–110

Air humidity58.6 % 57.4–60.3

Moisture balance-50.6 mm/mo -66.3–-10.9

Vapour deficit923 Pa 800–1,016

Wind speed3.20 m/s 2.50–3.30

Cloud cover43.6 % 38.4–47.5

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)