Acrobasis ostryella

Ely, 1913 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records48

Data sources7

Biological traits0

DNA specimens15

eDNA detections3

Sources7 archives

Databases and archives Acrobasis ostryella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility48 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF48 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD15 specimens

01Narrative

Acrobasis ostryella is a species of snout moth in the genus Acrobasis. It was described by Charles Russell Ely in 1913 and is known from Ontario in Canada and the eastern United States. There is one generation per year. The larvae feed on Ostrya virginiana. The species overwinters in the larval stage. After overwintering, young larvae feed on the undersurface of the base of a leaf. A tube is constructed and several nearby leaves are pulled together around the tube. The larvae usually leave this tube to construct a second one. Pupation takes place in a pupal chamber which is made at the end of the tube.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis ostryella has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.17%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 5 variable positions, in barcode order

342Cmostly conserved

358Tmostly conserved

400Tmostly conserved

613Tmostly conserved

616Tvariable

AACTTTATATTTTATTTTAGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTACTCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis betulellasame genus1.5%Acrobasis cunulaesame genus2.3%Acrobasis stigmellasame genus3.3%Acrobasis nuxvorellasame genus3.6%Paracrama dulcissimasame order10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type48 records

Wild obs. + sensor3

Museum / vouchered45

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤1 km 7≤10 km 3

10 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence45

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	19
Washington, US	17
East Lansing, US	7
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Mississippi Entomological Museumlocation not on record	1

5 institutions · 45 of 45 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Acrobasis ostryella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 22.9–26.2

Seasonal swing summer↔winter21.3 °C

Max temp (day)28.7 °C 26.1–31.3

Min temp (night)21.1 °C 20.0–22.1

Precipitation102 mm/mo 96.7–108

Air humidity60.9 % 60.9–61.0

Moisture balance-53.0 mm/mo -63.2–-42.8

Vapour deficit1,214 Pa 1,092–1,336

Wind speed1.90 m/s 1.40–2.40

Cloud cover31.8 % 27.6–36.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)