Acrobasis cunulae

Dyar & Heinrich, 1929 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records26

Data sources7

Biological traits0

DNA specimens8

eDNA detections9

Sources7 archives

Databases and archives Acrobasis cunulae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility26 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF26 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD8 specimens

01Narrative

Acrobasis cunulae is a species of snout moth in the genus Acrobasis. It was described by Harrison Gray Dyar Jr. and Heinrich, in 1929, and is known from Ontario, Canada, and eastern United States. There is one generation per year. The larvae feed on Carya species, including Carya illinoensis. Late stage larvae feed on the terminal leaflets of their host plant. They pull together the three most external leaflets with silk. They then construct a tube of frass and silk which is attached to the underside of the midrib of the central leaflet. They then feed on the three leaflets. Pupation takes place in a pupal chamber which is constructed at the end of the tube.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis cunulae has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.11%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 3 variable positions, in barcode order

88Amostly conserved

367Cmostly conserved

519Gmostly conserved

AACTTTATATTTTATTTTAGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTACTCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis caryivorellasame genus2.0%Acrobasis ostryellasame genus2.3%Acrobasis carpinivorellasame genus2.3%Acrobasis irrubriellasame genus2.3%Acrobasis rubrifasciellasame genus2.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type26 records

Wild obs. + sensor6

Museum / vouchered20

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 4≤10 km 1

5 georeferenced · 1 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 12>10 km 1

13 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	12
East Lansing, US	5
Washington, US	1

3 institutions · 18 of 20 vouchered records shown · 2 without an institution code

09Environmental DNA9 detections

Where the DNA of Acrobasis cunulae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.0 °C 16.8–21.0

Seasonal swing summer↔winter30.4 °C

Max temp (day)24.8 °C 22.1–26.1

Min temp (night)15.9 °C 11.5–16.4

Precipitation104 mm/mo 99.7–120

Air humidity58.3 % 58.2–59.9

Moisture balance-40.2 mm/mo -55.9–-20.4

Vapour deficit952 Pa 797–1,041

Wind speed3.30 m/s 2.50–3.50

Cloud cover42.9 % 39.1–45.4

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)