Acrobasis caryivorella

Ragonot, 1887 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records65

Data sources7

Biological traits0

DNA specimens5

eDNA detections1

Sources7 archives

Databases and archives Acrobasis caryivorella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility65 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF65 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD5 specimens

01Narrative

Acrobasis caryivorella, the pecan nursery casemaker, is a species of snout moth in the genus Acrobasis. It was described by Émile Louis Ragonot in 1887, and is known from southeastern Ontario, Canada, and the eastern United States. There are two to four generations per year. The larvae feed on Carya and Juglans species. Larvae of the first generation bore into the new growth of their host plant. The species overwinters in the larval stage. Larvae of the following generation hollow out the interior of the nut and pupate within.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis caryivorella has left across the world's sequence archives.

At a glance

DNA specimens5

BINs3

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 42 variable positions, in barcode order

10Tmostly conserved

49Tmostly conserved

67Amostly conserved

88Avariable

92Tmostly conserved

94Tmostly conserved

97Tmostly conserved

118Tmostly conserved

121Tmostly conserved

202Tmostly conserved

220Cvariable

223Amostly conserved

234Tmostly conserved

235Tmostly conserved

238Tmostly conserved

271Tvariable

280Cmostly conserved

283Tmostly conserved

286Tmostly conserved

292Cmostly conserved

304Cvariable

364Tmostly conserved

367Tmostly conserved

370Amostly conserved

400Cvariable

418Tmostly conserved

421Tmostly conserved

439Cvariable

448Tmostly conserved

451Amostly conserved

487Tmostly conserved

505Tmostly conserved

526Cvariable

530Tmostly conserved

539Tmostly conserved

542Tmostly conserved

601Tmostly conserved

613Cvariable

619Tmostly conserved

622Tmostly conserved

640Tmostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTAGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTACTCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.4%

Haplotypes4

BINs3

Most divergent pair4.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis betulivorellasame genus1.7%Acrobasis normellasame genus1.8%Acrobasis betulellasame genus2.0%Acrobasis cunulaesame genus2.0%Acrobasis nuxvorellasame genus3.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type65 records

Wild obs. + sensor1

Museum / vouchered64

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 20≤10 km 11>10 km 1

32 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence64

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	20
Washington, US	12
North Carolina State University Insect Museumlocation not on record	11
New Haven, US	8
St. Paul, US	8
Philadelphia, US	2
Mississippi State, US	1
US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

9 institutions · 64 of 64 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Acrobasis caryivorella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 23.5–23.5

Seasonal swing summer↔winter24.4 °C

Max temp (day)28.6 °C

Min temp (night)18.2 °C

Precipitation109 mm/mo

Air humidity56.8 %

Moisture balance-50.4 mm/mo

Vapour deficit1,250 Pa

Wind speed2.50 m/s

Cloud cover36.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)