Acrobasis betulivorella — The Life Data

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records14

Data sources6

Biological traits0

DNA specimens5

eDNA detections0

Sources6 archives

Databases and archives Acrobasis betulivorella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF14 records

DNA & barcodingBOLD5 specimens

01Narrative

Acrobasis betulivorella is a species of snout moth in the genus Acrobasis. It was described by Herbert H. Neunzig in 1975 and is often found in the eastern United States. The larvae feed on Betula species including Betula nigra.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis betulivorella has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.86%

Haplotypes1

BIN1

Where individuals differ — all 11 variable positions, in barcode order

163Amostly conserved

235Tmostly conserved

280Tvariable

358Tmostly conserved

376Avariable

451Amostly conserved

565Gvariable

616Cmostly conserved

625Amostly conserved

628Avariable

646Cvariable

AACTTTATATTTTATTTTAGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTACTCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis caryivorellasame genus1.7%Acrobasis normellasame genus1.7%Acrobasis sylviellasame genus1.8%Acrobasis betulellasame genus2.0%Acrobasis cunulaesame genus2.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type14 records

Museum / vouchered14

Range

Area of Occupancy AOO12 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the institutions mapphysical evidence14

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	13
Mississippi State, US	1

2 institutions · 14 of 14 vouchered records shown