Acrobasis carpinivorella

Neunzig, 1970 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records52

Data sources7

Biological traits0

DNA specimens36

eDNA detections7

Sources7 archives

Databases and archives Acrobasis carpinivorella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility52 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF52 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD36 specimens

01Narrative

Acrobasis carpinivorella is a species of snout moth in the genus Acrobasis. It was described by Herbert H. Neunzig in 1970, and is known from Ontario, Canada, and the eastern United States. There is one generation per year. The larvae feed on Carpinus caroliniana. The species overwinters in the larval stage. In spring, the larvae leave their winter shelter and resume feeding on the leaves of their host plant. They construct a silken tube on the underside of a recently expanded leaf. Last instar larvae leave the tube and resume feeding on the terminal leaf or shoot, again forming a tube. Pupation takes place in a pupal chamber which is constructed at the end of this tube.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis carpinivorella has left across the world's sequence archives.

At a glance

DNA specimens36

BINs1

Marker genes1

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

85Tmostly conserved

88Tmostly conserved

200Gmostly conserved

235Cmostly conserved

238Tmostly conserved

277Tmostly conserved

280Cmostly conserved

286Tmostly conserved

304Tmostly conserved

500Tmostly conserved

505Tvariable

526Cmostly conserved

556Tmostly conserved

601Tmostly conserved

613Cmostly conserved

631Gvariable

AACTTTATATTTTATTTTAGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTACTCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.69%

Haplotypes6

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis betulellasame genus1.5%Acrobasis cunulaesame genus2.3%Acrobasis stigmellasame genus3.6%Acrobasis aurorellasame genus3.8%Paracrama dulcissimasame order10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type52 records

Wild obs. + sensor1

Museum / vouchered51

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 1≤1 km 5≤10 km 4>10 km 1

11 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence51

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	16
New Haven, US	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Research Collection of Daniel Handfieldlocation not on record	5
Cornell University Insect Collectionlocation not on record	3
Mississippi State, US	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
East Lansing, US	2
Georgia Museum of Natural Historylocation not on record	2
CUlocation not on record	1

10 institutions · 43 of 51 vouchered records shown · 8 without an institution code

09Environmental DNA7 detections

Where the DNA of Acrobasis carpinivorella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C 18.4–19.9

Seasonal swing summer↔winter30.7 °C

Max temp (day)23.7 °C 22.2–24.5

Min temp (night)15.2 °C 14.6–16.5

Precipitation107 mm/mo 92.8–116

Air humidity59.8 % 58.1–61.6

Moisture balance-39.5 mm/mo -50.6–-22.8

Vapour deficit850 Pa 841–961

Wind speed3.40 m/s 2.70–4.20

Cloud cover45.8 % 39.9–48.8

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)