Acrobasis obtusella

Hübner, 1796 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records160

Data sources7

Biological traits0

DNA specimens16

eDNA detections16

Sources7 archives

Databases and archives Acrobasis obtusella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility160 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF160 records

Environmental DNA1 datasets · 5 countries16 detections

DNA & barcodingBOLD16 specimens

01Narrative

Acrobasis obtusella is a species of snout moth in the genus Acrobasis. It was described by Jacob Hübner in 1796. It is found in most of Europe. The wingspan is 15–17 mm. The larvae feed on Pyrus species. They feed on the tissues of the leaf which they fold irregularly.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis obtusella has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections16

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

67Amostly conserved

160Amostly conserved

202Cmostly conserved

235Tmostly conserved

263Tmostly conserved

271Cmostly conserved

586Amostly conserved

589Tmostly conserved

634Tmostly conserved

643Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGACTTTTAATTCGAGCTGAACTAGGTACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.20%

Haplotypes3

BIN1

Most divergent pair1.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis marmoreasame genus6.1%Ancylosis roscidellasame family6.2%Acrobasis ostryellasame genus6.5%Acrobasis caryivorellasame genus6.5%Acrobasis obliquasame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type160 records

Wild obs. + sensor102

Museum / vouchered40

Other18

Range

Area of Occupancy AOO440 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 34≤1 km 14≤10 km 39>10 km 1

88 georeferenced · 14 without coordinates

Open the mapobservation + sensor102

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 3≤1 km 12≤10 km 4

19 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence40

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	7
Provincia di Livornolocation not on record	5
ZSMlocation not on record	3
Tartu, EE	2
University of Kaiserslauternlocation not on record	2
ZAF-UMUlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Salzburg, AT	1

10 institutions · 24 of 40 vouchered records shown · 16 without an institution code

09Environmental DNA16 detections

Where the DNA of Acrobasis obtusella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map5 countries0

coastal scrub, large Tamarix

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C 17.7–20.3

Seasonal swing summer↔winter18.5 °C

Max temp (day)23.5 °C 22.0–25.4

Min temp (night)13.9 °C 13.0–15.2

Precipitation73.0 mm/mo 31.8–91.9

Air humidity57.0 % 52.6–58.3

Moisture balance-54.5 mm/mo -122–-22.4

Vapour deficit941 Pa 840–1,140

Wind speed2.80 m/s 2.40–4.70

Cloud cover32.9 % 24.8–37.1

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)