Acrobasis marmorea

(Haworth, 1811) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records2 401

Data sources7

Biological traits0

DNA specimens35

eDNA detections48

Sources7 archives

Databases and archives Acrobasis marmorea's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 401 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI48 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 401 records

Environmental DNA3 datasets · 8 countries48 detections

DNA & barcodingBOLD35 specimens

01Narrative

Acrobasis marmorea is a moth of the family Pyralidae. It is found in Europe. The wingspan is 18–23 mm. The moth flies in one generation from June to August.Goater, Barry (1986) British Pyralid Moths: A Guide to their Identification. Colchester: Harley Books. pp. 107–8. ISBN 0-946589-08-9. Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description . Fig. 6 larva after final moult The caterpillars feed on hawthorn and blackthorn.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis marmorea has left across the world's sequence archives.

At a glance

DNA specimens35

BINs1

Marker genes1

eDNA detections48

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

220Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGATCTGGAATAGTAGGAACATCTTTAAGTCTATTAATTCGAGCTGAATTAGGGACCCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.13%

Haplotypes6

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis ostryellasame genus6.1%Acrobasis obtusellasame genus6.1%Acrobasis comptoniellasame genus6.2%Acrobasis betulivorellasame genus6.4%Acrobasis sylviellasame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 401 records

Wild obs. + sensor2 243

Museum / vouchered158

Range

Area of Occupancy AOO4 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 1 038≤1 km 593≤10 km 346>10 km 2

1 979 georeferenced · 264 without coordinates

Open the mapobservation + sensor2 243

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 65≤1 km 38≤10 km 22

125 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence158

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	50
SLU Artdatabankenlocation not on record	32
NHMOlocation not on record	26
Nijmegen, NL	16
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	12
Provincia di Livornolocation not on record	3
Tartu, EE	3
University of Kaiserslauternlocation not on record	3
ZSMlocation not on record	2
Zürich, CH	1
CBDClocation not on record	1

11 institutions · 149 of 158 vouchered records shown · 9 without an institution code

09Environmental DNA48 detections

Where the DNA of Acrobasis marmorea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found48

Studies independent surveys3

Countries8

Verifiable raw sequence linked13

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 48 detections have coordinates

Open the map8 countries0

edge woodland/meadowprivate gardeninside forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 13.2–18.1

Seasonal swing summer↔winter16.9 °C

Max temp (day)19.9 °C 15.2–22.4

Min temp (night)13.0 °C 7.90–15.6

Precipitation63.2 mm/mo 45.7–111

Air humidity58.5 % 57.6–61.7

Moisture balance-67.1 mm/mo -87.0–10.0

Vapour deficit751 Pa 591–876

Wind speed3.60 m/s 2.30–5.20

Cloud cover39.6 % 33.6–43.3

CHELSA 1981–2010, ~9 km grid, at location & month of 47 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acrobasis marmorea

At a glance

Sources7 archives

At a glance

Record type2 401 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 401 records