Acrobasis comptoniella

Hulst, 1890 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records219

Data sources6

Biological traits0

DNA specimens13

eDNA detections1

Sources6 archives

Databases and archives Acrobasis comptoniella's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility219 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF219 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD13 specimens

01Narrative

Acrobasis comptoniella is een vlinder uit de familie van de snuitmotten (Pyralidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1890 door Hulst.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis comptoniella has left across the world's sequence archives.

At a glance

DNA specimens13

BINs4

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 50 variable positions, in barcode order

4Tmostly conserved

10Tmostly conserved

49Tmostly conserved

67Amostly conserved

85Tmostly conserved

88Tmostly conserved

92Tmostly conserved

103Tmostly conserved

118Tmostly conserved

154Tmostly conserved

178Tmostly conserved

220Tmostly conserved

223Amostly conserved

235Tvariable

238Tmostly conserved

266Tvariable

268Avariable

271Cvariable

274Tvariable

280Cvariable

283Tmostly conserved

292Tvariable

304Tmostly conserved

319Tmostly conserved

364Cvariable

370Amostly conserved

397Tmostly conserved

400Tmostly conserved

418Tmostly conserved

421Tmostly conserved

424Amostly conserved

427Tmostly conserved

439Tmostly conserved

448Tmostly conserved

451Amostly conserved

460Tvariable

475Tmostly conserved

479Tmostly conserved

487Tmostly conserved

500Tmostly conserved

526Cmostly conserved

539Tmostly conserved

556Tmostly conserved

574Tmostly conserved

613Cvariable

619Tmostly conserved

622Cvariable

631Amostly conserved

643Tmostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTAGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTACTCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes6

BINs4

Most divergent pair4.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis cunulaesame genus2.4%Acrobasis nuxvorellasame genus3.6%Acrobasis juglandissame genus3.8%Paracrama dulcissimasame order10.7%Eligma narcissussame order11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type219 records

Wild obs. + sensor17

Museum / vouchered202

Range

Area of Occupancy AOO200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 10≤1 km 1≤10 km 1>10 km 2

14 georeferenced · 3 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤1 km 30≤10 km 65>10 km 19

114 georeferenced · 88 without coordinates

Open the institutions mapphysical evidence202

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	84
East Lansing, US	53
Philadelphia, US	33
New Haven, US	27
Cornell University Insect Collectionlocation not on record	2
Cambridge, US	1
Research Collection of Daniel Handfieldlocation not on record	1

7 institutions · 201 of 202 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Acrobasis comptoniella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 18.2–18.2

Seasonal swing summer↔winter30.0 °C

Max temp (day)22.8 °C

Min temp (night)14.1 °C

Precipitation130 mm/mo

Air humidity59.8 %

Moisture balance-8.60 mm/mo

Vapour deficit844 Pa

Wind speed3.00 m/s

Cloud cover45.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)