Acrobasis obliqua

Zeller, 1847 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records1 890

Data sources7

Biological traits0

DNA specimens42

eDNA detections21

Sources7 archives

Databases and archives Acrobasis obliqua's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 890 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 890 records

Environmental DNA1 datasets · 2 countries21 detections

DNA & barcodingBOLD42 specimens

01Narrative

Acrobasis obliqua is a moth of the family Pyralidae. It is found in southern Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis obliqua has left across the world's sequence archives.

At a glance

DNA specimens42

BINs4

Marker genes1

eDNA detections21

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus42 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

37Amostly conserved

43Tvariable

55Tvariable

157Tmostly conserved

187Cvariable

190Avariable

235Cmostly conserved

271Tvariable

274Cvariable

280Avariable

287Cvariable

340Cmostly conserved

368Gmostly conserved

388Avariable

403Avariable

421Cmostly conserved

463Tmostly conserved

484Tvariable

517Cmostly conserved

529Cmostly conserved

613Cvariable

AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGTACATCTTTAAGTCTTTTAATTCGTGCTGAATTAGGTACTCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes18

BINs4

Most divergent pair3.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis bithynellasame genus4.4%Acrobasis centunculellasame genus5.0%Acrobasis klimeschisame genus5.5%Acrobasis comptoniellasame genus5.9%Acrobasis normellasame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 890 records

Wild obs. + sensor1 759

Museum / vouchered118

Other13

Range

Area of Occupancy AOO2 860 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 602≤1 km 449≤10 km 188>10 km 37

1 276 georeferenced · 483 without coordinates

Open the mapobservation + sensor1 759

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy98% within 1 km

≤100 m 4≤1 km 41≤10 km 1

46 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence118

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	41
ZAF-UMUlocation not on record	39
Nijmegen, NL	23
Tartu, EE	6
DABUHlocation not on record	4
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Salzburg, AT	1

7 institutions · 115 of 118 vouchered records shown · 3 without an institution code

09Environmental DNA21 detections

Where the DNA of Acrobasis obliqua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map2 countries0

garden/forest edge/olive field/meadowdry forest/riverbank

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 11.2–18.9

Seasonal swing summer↔winter14.5 °C

Max temp (day)19.0 °C 12.8–20.1

Min temp (night)10.1 °C 9.70–17.4

Precipitation30.6 mm/mo 14.7–34.1

Air humidity55.2 % 48.0–58.3

Moisture balance-102 mm/mo -130–-91.1

Vapour deficit765 Pa 697–908

Wind speed2.30 m/s 1.70–5.60

Cloud cover33.5 % 28.9–36.1

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acrobasis obliqua

At a glance

Sources7 archives

At a glance

Record type1 890 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 890 records