Acrobasis bithynella

Zeller, 1848 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records376

Data sources7

Biological traits0

DNA specimens51

eDNA detections53

Sources7 archives

Databases and archives Acrobasis bithynella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility376 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI53 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics51 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF376 records

Environmental DNA1 datasets · 4 countries53 detections

DNA & barcodingBOLD51 specimens

01Narrative

Acrobasis bithynella is a species of snout moth in the genus Acrobasis. It was described by Philipp Christoph Zeller in 1848, and is known from France, the Iberian Peninsula, Italy, Croatia, Crete, Turkey and Russia. The wingspan is about 20 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding51 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis bithynella has left across the world's sequence archives.

At a glance

DNA specimens51

BINs1

Marker genes1

eDNA detections53

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus51 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

129Gmostly conserved

131Gmostly conserved

269Cmostly conserved

281Tmostly conserved

338Tmostly conserved

366Amostly conserved

401Gmostly conserved

440Cmostly conserved

488Cmostly conserved

623Amostly conserved

CTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGTACATCTTTAAGTCTTTTAATTCGTGCTGAATTAGGAACTCCTGGATCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.82%

Haplotypes11

BIN1

Most divergent pair1.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis obliquasame genus4.4%Acrobasis centunculellasame genus5.0%Acrobasis comptoniellasame genus5.8%Acrobasis ostryellasame genus6.0%Acrobasis normellasame genus6.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type376 records

Wild obs. + sensor344

Museum / vouchered26

Other6

Origin

Native1

Range

Area of Occupancy AOO944 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 70≤1 km 101≤10 km 30>10 km 43

244 georeferenced · 100 without coordinates

Open the mapobservation + sensor344

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ZAF-UMUlocation not on record	14
Zürich, CH	2
Kawasaki Shi Tama Ku, JP	1

3 institutions · 17 of 26 vouchered records shown · 9 without an institution code

09Environmental DNA53 detections

Where the DNA of Acrobasis bithynella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found53

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 53 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.6 °C 15.7–21.2

Seasonal swing summer↔winter15.6 °C

Max temp (day)20.1 °C 17.7–23.2

Min temp (night)14.6 °C 11.8–16.8

Precipitation89.4 mm/mo 54.0–118

Air humidity59.4 % 57.6–62.7

Moisture balance5.50 mm/mo -30.1–38.4

Vapour deficit796 Pa 712–992

Wind speed2.90 m/s 1.80–3.20

Cloud cover41.5 % 36.3–43.2

CHELSA 1981–2010, ~9 km grid, at location & month of 45 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)