Acrobasis latifasciella — The Life Data

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records12

Data sources6

Biological traits0

DNA specimens4

eDNA detections0

Sources6 archives

Databases and archives Acrobasis latifasciella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF12 records

DNA & barcodingBOLD4 specimens

01Narrative

Acrobasis latifasciella is a species of snout moth in the genus Acrobasis. It was described by Harrison Gray Dyar Jr., in 1908, and is known from the northeastern United States. The larvae feed on Juglans nigra and possibly Carya species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis latifasciella has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACTTTATATTTTATTTTAGGAATTTGATCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGAACTCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis exsulellasame genus2.7%Acrobasis demotellasame genus3.6%Acrobasis ostryellasame genus3.8%Acrobasis comptoniellasame genus3.8%Acrobasis cunulaesame genus3.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type12 records

Museum / vouchered12

Range

Area of Occupancy AOO24 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤1 km 1≤10 km 9

10 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence12

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	10
Cornell University Insect Collectionlocation not on record	1
Washington, US	1

3 institutions · 12 of 12 vouchered records shown