Acrobasis exsulella

Zeller, 1848 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records267

Data sources7

Biological traits0

DNA specimens12

eDNA detections12

Sources7 archives

Databases and archives Acrobasis exsulella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility267 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF267 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD12 specimens

01Narrative

Acrobasis exsulella, cordovan pyralid, Size: 9 mm Acrobasis exsulella, cordovan pyralid Acrobasis exsulella, the cordovan pyralid moth, is a species of snout moth in the genus Acrobasis. It was described by Philipp Christoph Zeller in 1848, and is known from the southeastern United States.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis exsulella has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes1

eDNA detections12

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Diversity (π)1.1%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 44 variable positions, in barcode order

19Amostly conserved

31Amostly conserved

38Gmostly conserved

40Amostly conserved

49Amostly conserved

55Amostly conserved

83Cmostly conserved

85Tmostly conserved

91Tmostly conserved

92Cmostly conserved

94Cmostly conserved

100Amostly conserved

131Amostly conserved

139Cmostly conserved

163Amostly conserved

202Cmostly conserved

235Cmostly conserved

238Cmostly conserved

271Cmostly conserved

274Cmostly conserved

286Tmostly conserved

301Amostly conserved

337Amostly conserved

358Cmostly conserved

373Tmostly conserved

382Tmostly conserved

386Cmostly conserved

391Amostly conserved

400Amostly conserved

401Tmostly conserved

403Amostly conserved

412Tmostly conserved

433Amostly conserved

472Amostly conserved

478Amostly conserved

506Amostly conserved

508Tmostly conserved

514Cmostly conserved

517Tmostly conserved

589Tmostly conserved

596Tmostly conserved

598Amostly conserved

601Tmostly conserved

607Cmostly conserved

AACTTTATATTTTATTTTAGGAATTTGATCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGAACTCCTGGCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis angusellasame genus2.7%Acrobasis latifasciellasame genus2.7%Acrobasis demotellasame genus2.9%Acrobasis aurorellasame genus3.8%Acrobasis stigmellasame genus4.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type267 records

Wild obs. + sensor208

Museum / vouchered59

Range

Area of Occupancy AOO568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 105≤1 km 42≤10 km 5>10 km 17

169 georeferenced · 39 without coordinates

Open the mapobservation + sensor208

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 1≤1 km 21≤10 km 18>10 km 1

41 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence59

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	46
New Haven, US	5
North Carolina State University Insect Museumlocation not on record	4
CUlocation not on record	1
Georgia Museum of Natural Historylocation not on record	1

5 institutions · 57 of 59 vouchered records shown · 2 without an institution code

09Environmental DNA12 detections

Where the DNA of Acrobasis exsulella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 13.9–27.4

Seasonal swing summer↔winter24.4 °C

Max temp (day)28.3 °C 19.2–33.0

Min temp (night)19.2 °C 8.30–23.1

Precipitation99.1 mm/mo 81.8–143

Air humidity56.2 % 54.6–60.9

Moisture balance-63.1 mm/mo -118–9.40

Vapour deficit1,282 Pa 660–1,666

Wind speed3.40 m/s 2.70–3.90

Cloud cover32.8 % 27.1–38.8

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)