Acrobasis angusella

Grote, 1880 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records444

Data sources7

Biological traits0

DNA specimens26

eDNA detections29

Sources7 archives

Databases and archives Acrobasis angusella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility444 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF444 records

Environmental DNA1 datasets · 2 countries29 detections

DNA & barcodingBOLD26 specimens

01Narrative

Acrobasis angusella, the hickory leafstem borer or leafstem borer, is a species of snout moth in the genus Acrobasis. It was described by Augustus Radcliffe Grote in 1880, and is known from Quebec, Canada, and northeastern United States. The wingspan is about 18 mm. Adults are on wing from May to September. The larvae feed on Carya species, including Carya glabra, Carya ovalis and Carya tomentosa. They bore in the leaf stems of their host plant, causing the leaves to fall off.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis angusella has left across the world's sequence archives.

At a glance

DNA specimens26

BINs1

Marker genes1

eDNA detections29

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

497Amostly conserved

AACTTTATATTTTATTTTAGGAATTTGATCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGAACTCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.09%

Haplotypes4

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis exsulellasame genus2.7%Acrobasis demotellasame genus3.6%Acrobasis ostryellasame genus3.8%Acrobasis comptoniellasame genus3.8%Acrobasis cunulaesame genus3.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type444 records

Wild obs. + sensor361

Museum / vouchered83

Range

Area of Occupancy AOO848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 181≤1 km 68≤10 km 60>10 km 10

319 georeferenced · 42 without coordinates

Open the mapobservation + sensor361

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 4≤1 km 13≤10 km 9

26 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence83

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
North Carolina State University Insect Museumlocation not on record	33
New Haven, US	13
Mississippi State, US	9
East Lansing, US	8
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Philadelphia, US	2
Decorah, US	2
Research Collection of Brian Scholtenslocation not on record	1
Research Collection of Daniel Handfieldlocation not on record	1
SOVTlocation not on record	1
Cornell University Insect Collectionlocation not on record	1

11 institutions · 75 of 83 vouchered records shown · 8 without an institution code

09Environmental DNA29 detections

Where the DNA of Acrobasis angusella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map2 countries0

Temperate mixed forestGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 16.5–21.2

Seasonal swing summer↔winter28.8 °C

Max temp (day)25.1 °C 21.5–25.9

Min temp (night)15.8 °C 12.7–16.9

Precipitation98.9 mm/mo 83.0–158

Air humidity59.6 % 58.5–62.2

Moisture balance-41.6 mm/mo -62.3–12.2

Vapour deficit931 Pa 696–1,028

Wind speed2.90 m/s 2.10–3.50

Cloud cover42.7 % 28.2–48.5

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)