Acrobasis glaucella

Staudinger, 1859 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records524

Data sources7

Biological traits0

DNA specimens44

eDNA detections77

Sources7 archives

Databases and archives Acrobasis glaucella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility524 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI77 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF524 records

Environmental DNA1 datasets · 12 countries77 detections

DNA & barcodingBOLD44 specimens

01Narrative

Acrobasis glaucella is a moth of the family Pyralidae described by Otto Staudinger in 1859."Acrobasis Zeller, 1839" at Markku Savela's Lepidoptera and Some Other Life Forms. Retrieved June 16, 2017. It is found in most of Europe. The wingspan is 19–23 mm. Adults are on wing from June to August. The larva feed on various oak species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis glaucella has left across the world's sequence archives.

At a glance

DNA specimens44

BINs1

Marker genes1

eDNA detections77

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus44 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

88Amostly conserved

160Avariable

181Gvariable

205Tmostly conserved

217Amostly conserved

274Tmostly conserved

478Gvariable

565Amostly conserved

628Gvariable

640Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGTGCTGAATTGGGAACTCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.62%

Haplotypes11

BIN1

Most divergent pair1.4%

EuropeAfricaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis comptoniellasame genus6.5%Acrobasis ostryellasame genus6.7%Acrobasis carpinivorellasame genus6.7%Acrobasis caryivorellasame genus6.7%Acrobasis irrubriellasame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type524 records

Wild obs. + sensor479

Museum / vouchered28

Other17

Origin

Native2

Range

Area of Occupancy AOO752 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 177≤1 km 80≤10 km 82>10 km 1

340 georeferenced · 139 without coordinates

Open the mapobservation + sensor479

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤1 km 5≤10 km 1

6 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Nijmegen, NL	13
ZSMlocation not on record	4
Provincia di Livornolocation not on record	3
Natural History Museum Rotterdamlocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1

5 institutions · 23 of 28 vouchered records shown · 5 without an institution code

09Environmental DNA77 detections

Where the DNA of Acrobasis glaucella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found77

Studies independent surveys1

Countries12

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 77 detections have coordinates

Open the map12 countries0

oakwoodlandscrub, forest edgeedge woodland/meadow1. Forest & Woodland|1.4. Temperate ForestDunes, pinesdry grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 14.0–24.0

Seasonal swing summer↔winter15.4 °C

Max temp (day)24.4 °C 15.8–27.0

Min temp (night)15.2 °C 10.1–21.6

Precipitation48.8 mm/mo 8.10–89.4

Air humidity57.6 % 54.1–63.6

Moisture balance-66.4 mm/mo

Vapour deficit982 Pa 620–1,233

Wind speed3.50 m/s

Cloud cover33.9 % 20.0–40.2

CHELSA 1981–2010, ~9 km grid, at location & month of 71 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)