Acrobasis consociella

Hübner, 1813 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records8 699

Data sources7

Biological traits0

DNA specimens83

eDNA detections96

Sources7 archives

Databases and archives Acrobasis consociella's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 699 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI96 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics83 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF8 699 records

Environmental DNA3 datasets · 12 countries96 detections

DNA & barcodingBOLD83 specimens

Genome at a glanceGoaT≈598 Mbp

01Narrative

Acrobasis consociella is a moth of the family Pyralidae. It is found in Europe. Acrobasis consociella larva Moth on an oak leaf The wingspan is 19–22 mm. The moth flies in one generation from the end of May to August. The larva feed on oak.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding83 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis consociella has left across the world's sequence archives.

At a glance

DNA specimens83

BINs2

Marker genes1

eDNA detections96

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus82 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

100Avariable

217Avariable

229Avariable

266Cvariable

287Cvariable

289Tvariable

322Gvariable

364Cvariable

394Tvariable

454Cvariable

457Tvariable

460Cvariable

463Tvariable

484Tvariable

490Tvariable

505Cvariable

565Amostly conserved

592Tvariable

616Tvariable

628Avariable

634Cvariable

646Tvariable

AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGTACTCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes15

BINs2

Most divergent pair3.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis sodalellasame genus2.7%Acrobasis normellasame genus5.3%Acrobasis betulellasame genus5.5%Acrobasis demotellasame genus5.6%Acrobasis comptoniellasame genus5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Acrobasis consociella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈598 393 298 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acrobasis consociella0.60 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.8% BUSCO

08Occurrence & distribution

Record type8 699 records

Wild obs. + sensor7 809

Museum / vouchered842

Other48

Origin

Native3

Range

Area of Occupancy AOO9 832 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 1 849≤1 km 971≤10 km 4 340>10 km 22

7 182 georeferenced · 627 without coordinates

Open the mapobservation + sensor7 809

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 162≤1 km 354≤10 km 195>10 km 49

760 georeferenced · 82 without coordinates

Open the institutions mapphysical evidence842

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	383
DanishLepidopterologicalSocietylocation not on record	136
NHMOlocation not on record	61
Provincia di Livornolocation not on record	41
SLU Artdatabankenlocation not on record	40
Nijmegen, NL	32
Tartu, EE	28
NTNU-VMlocation not on record	14
Stockholm, SE	13
Adam Mickiewicz University in Poznańlocation not on record	7
Natural History Museum Rotterdamlocation not on record	6
Salzburg, AT	6
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	6
Zürich, CH	5
South Kensington, GB	4
European Distributed Institute of Taxonomy (EDIT)location not on record	4
ZSMlocation not on record	3
Kuopio, FI	3
neflocation not on record	2
Philadelphia, US	2
CBDClocation not on record	2
DABUHlocation not on record	2
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	2
Research Collection of Peter Lichtmanneckerlocation not on record	1
Rovaniemi, FI	1
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	1

26 institutions · 805 of 842 vouchered records shown · 37 without an institution code

09Environmental DNA96 detections

Where the DNA of Acrobasis consociella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found96

Studies independent surveys3

Countries12

Verifiable raw sequence linked13

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 96 detections have coordinates

Open the map12 countries0

edge woodland/meadowinside oakwoodland Quercus pubescensprivate gardenforest, mainly oakmanaged oakwoodlandbirch forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 14.7–21.2

Seasonal swing summer↔winter17.5 °C

Max temp (day)21.5 °C 18.2–25.1

Min temp (night)13.1 °C 10.4–15.9

Precipitation74.4 mm/mo 45.7–127

Air humidity59.0 % 56.7–62.2

Moisture balance-39.6 mm/mo -82.4–34.1

Vapour deficit804 Pa 674–1,106

Wind speed2.80 m/s 1.90–4.20

Cloud cover39.4 % 31.4–45.1

CHELSA 1981–2010, ~9 km grid, at location & month of 89 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acrobasis consociella

At a glance

Sources7 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type8 699 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 699 records