Acrobasis sodalella

Zeller, 1848 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records475

Data sources7

Biological traits0

DNA specimens12

eDNA detections12

Sources7 archives

Databases and archives Acrobasis sodalella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility475 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF475 records

Environmental DNA1 datasets · 7 countries12 detections

DNA & barcodingBOLD12 specimens

01Narrative

Acrobasis sodalella is a moth of the family Pyralidae. It was described by Philipp Christoph Zeller in 1848 and is found in Europe."Acrobasis Zeller, 1839" at Markku Savela's Lepidoptera and Some Other Life Forms. Retrieved June 16, 2017. The moth flies in one generation from June to July. The larvae feed on oak.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis sodalella has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections12

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

25Tmostly conserved

40Tmostly conserved

154Cvariable

271Cmostly conserved

307Gmostly conserved

403Amostly conserved

517Gvariable

547Tmostly conserved

548Tvariable

562Amostly conserved

625Amostly conserved

628Gmostly conserved

637Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGTACTCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.64%

Haplotypes6

BIN1

Most divergent pair2.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis consociellasame genus2.7%Acrobasis demotellasame genus4.9%Acrobasis ostryellasame genus5.6%Acrobasis sylviellasame genus5.8%Acrobasis comptoniellasame genus5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type475 records

Wild obs. + sensor342

Museum / vouchered89

Other44

Range

Area of Occupancy AOO1 208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 100≤1 km 77≤10 km 78>10 km 44

299 georeferenced · 43 without coordinates

Open the mapobservation + sensor342

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 19≤1 km 37≤10 km 29

85 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence89

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	39
NHMOlocation not on record	17
Provincia di Livornolocation not on record	12
Zürich, CH	3
DanishLepidopterologicalSocietylocation not on record	3
NTNU-VMlocation not on record	2
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
Radicondoli, IT	2
Nijmegen, NL	1
Tartu, EE	1
Natural History Museum Rotterdamlocation not on record	1
DABUHlocation not on record	1
SLU Artdatabankenlocation not on record	1
ZAF-UMUlocation not on record	1

14 institutions · 86 of 89 vouchered records shown · 3 without an institution code

09Environmental DNA12 detections

Where the DNA of Acrobasis sodalella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map7 countries0

futaiejuniperus forestdry grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 15.0–20.6

Seasonal swing summer↔winter18.0 °C

Max temp (day)21.2 °C 18.8–25.2

Min temp (night)12.9 °C 9.20–15.7

Precipitation69.9 mm/mo 45.7–113

Air humidity58.1 % 55.3–59.0

Moisture balance-61.0 mm/mo -89.3–-9.80

Vapour deficit848 Pa 726–1,068

Wind speed2.80 m/s 2.20–3.70

Cloud cover36.0 % 33.2–43.2

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)