Acrobasis caryae

Grote, 1881 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records249

Data sources6

Biological traits0

DNA specimens41

eDNA detections0

Sources6 archives

Databases and archives Acrobasis caryae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility249 records↗

BOLD SystemsCentre for Biodiversity Genomics41 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF249 records

DNA & barcodingBOLD41 specimens

01Narrative

Acrobasis caryae, hickory shoot borer Acrobasis caryae, hickory shoot borer, Size: 8.8 mm Acrobasis caryae, the hickory shoot borer, is a species of snout moth in the genus Acrobasis. It was described by Augustus Radcliffe Grote in 1881, and is known from southeastern Ontario, Canada, and the eastern United States. The larvae feed on Carya species, including Carya cordiformis, Carya tomentosa, Carya pallida, Carya glabra, Carya ovata and Carya carolinae-septentrionalis. They feed within the shoots of their host plant.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding41 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis caryae has left across the world's sequence archives.

At a glance

DNA specimens41

BINs2

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus40 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

31Amostly conserved

49Cmostly conserved

118Cmostly conserved

217Amostly conserved

283Cmostly conserved

304Cvariable

349Tmostly conserved

400Cmostly conserved

616Tvariable

AACTTTATACTTTATTTTAGGAATTTGATCAGGAATAGTAGGAACATCCTTAAGATTATTAATTCGTGCTGAATTAGGTACTCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.70%

Haplotypes12

BINs2

Most divergent pair5.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis caryivorellasame genus3.2%Acrobasis ostryellasame genus3.8%Acrobasis comptoniellasame genus3.8%Acrobasis sylviellasame genus4.3%Acrobasis betulellasame genus4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type249 records

Wild obs. + sensor160

Museum / vouchered89

Range

Area of Occupancy AOO492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 75≤1 km 28≤10 km 24>10 km 6

133 georeferenced · 27 without coordinates

Open the mapobservation + sensor160

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤1 km 20≤10 km 33>10 km 5

58 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence89

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	29
Mississippi State, US	13
Washington, US	13
Philadelphia, US	11
Georgia Museum of Natural Historylocation not on record	8
New Haven, US	3
US	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Cornell University Insect Collectionlocation not on record	2
CUlocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

12 institutions · 87 of 89 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)