Acraea ranavalona

Boisduval, 1833 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Acraea

At a glance

Occurrence records481

Data sources7

Biological traits0

DNA specimens9

eDNA detections42

Sources7 archives

Databases and archives Acraea ranavalona's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility481 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF481 records

Environmental DNA2 datasets · 1 countries42 detections

DNA & barcodingBOLD9 specimens

01Narrative

Acraea ranavalona butterflies mating, Anjajavy Forest, Madagascar Acraea ranavalona is a butterfly in the family Nymphalidae. It is found on Madagascar and the Comoros.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acraea ranavalona has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections42

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.67%

Haplotypes2

BIN1

Most divergent pair0.76%

Where individuals differ — all 11 variable positions, in barcode order

34Gvariable

118Tmostly conserved

250Tmostly conserved

433Avariable

490Cvariable

517Gvariable

562Tmostly conserved

571Tmostly conserved

607Cmostly conserved

619Amostly conserved

628Avariable

AACTTTATATTTTATTTTTGGTATTTGATCTGGGATAATTGGAACATCTTTAAGATTATTAATTCGAACAGAATTGGGTAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acraea boopissame genus7.0%Acraea leucographasame genus7.4%Acraea neobulesame genus7.6%Acraea endoscotasame genus7.7%Acraea mahelasame genus7.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type481 records

Wild obs. + sensor149

Museum / vouchered332

Range

Area of Occupancy AOO596 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 42≤1 km 30≤10 km 41>10 km 8

121 georeferenced · 28 without coordinates

Open the mapobservation + sensor149

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 27>10 km 19

46 georeferenced · 286 without coordinates

Open the institutions mapphysical evidence332

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
African Butterfly Research Institutelocation not on record	284
Cambridge, US	19
New Haven, US	14
Natural History Museum Rotterdamlocation not on record	11
Yokosuka City Museumlocation not on record	2
Natural History Museum of Utahlocation not on record	1
Cornell University Insect Collectionlocation not on record	1

7 institutions · 332 of 332 vouchered records shown

09Environmental DNA42 detections

Where the DNA of Acraea ranavalona was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found42

Studies independent surveys2

Countries1

Verifiable raw sequence linked23

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 42 detections have coordinates

Open the map1 country0

1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.8 °C 24.6–27.5

Seasonal swing summer↔winter6.30 °C

Max temp (day)30.7 °C 29.1–31.2

Min temp (night)22.9 °C 19.1–24.5

Precipitation82.4 mm/mo 10.2–342

Air humidity60.7 % 56.2–65.6

Moisture balance-106 mm/mo -162–166

Vapour deficit1,329 Pa 1,154–1,552

Wind speed2.10 m/s 1.80–4.00

Cloud cover19.0 % 9.00–49.2

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)