Acraea neobule

Doubleday, 1847 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Acraea

At a glance

Occurrence records2 540

Data sources8

Biological traits0

DNA specimens26

eDNA detections26

Sources8 archives

Databases and archives Acraea neobule's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 540 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 540 records

Environmental DNA1 datasets · 6 countries26 detections

DNA & barcodingBOLD26 specimens

01Narrative

Acraea neobule, the wandering donkey acraea, is a butterfly of the family Nymphalidae. It is found in Sub-Saharan Africa and south-western Arabia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acraea neobule has left across the world's sequence archives.

At a glance

DNA specimens26

BINs1

Marker genes1

eDNA detections26

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 72 variable positions, in barcode order

34Amostly conserved

43Amostly conserved

59Cmostly conserved

70Amostly conserved

76Amostly conserved

82Cmostly conserved

85Amostly conserved

88Gmostly conserved

89Tmostly conserved

91Cmostly conserved

100Amostly conserved

121Tmostly conserved

133Cmostly conserved

169Amostly conserved

181Tmostly conserved

190Amostly conserved

238Cmostly conserved

250Tmostly conserved

256Tmostly conserved

263Cmostly conserved

265Tmostly conserved

266Tmostly conserved

274Cmostly conserved

277Amostly conserved

282Tmostly conserved

283Tmostly conserved

284Tmostly conserved

286Amostly conserved

294Cmostly conserved

304Tmostly conserved

307Tmostly conserved

322Tmostly conserved

337Tmostly conserved

355Amostly conserved

364Cmostly conserved

368Gmostly conserved

370Tmostly conserved

373Amostly conserved

376Amostly conserved

391Cmostly conserved

394Tmostly conserved

401Cmostly conserved

403Tmostly conserved

415Amostly conserved

424Tmostly conserved

436Amostly conserved

451Amostly conserved

470Gmostly conserved

472Amostly conserved

474Amostly conserved

475Tmostly conserved

479Tmostly conserved

484Tmostly conserved

492Amostly conserved

506Gmostly conserved

508Tmostly conserved

514Amostly conserved

517Tmostly conserved

520Tmostly conserved

523Cmostly conserved

530Cmostly conserved

532Tmostly conserved

542Cmostly conserved

557Tmostly conserved

559Amostly conserved

562Amostly conserved

568Tmostly conserved

578Tmostly conserved

586Cmostly conserved

592Tmostly conserved

625Tmostly conserved

628Tmostly conserved

AACTTTATATTTTATTTTTGGTATTTGATCTGGAATAATTGGAACATCTTTAAGTTTACTAATTCGAACAGAATTAGGTAACCCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes5

BIN1

Most divergent pair1.1%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acraea eltringhamisame genus2.6%Acraea andromachasame genus2.9%Acraea violaesame genus3.0%Acraea insignissame genus3.2%Acraea hortasame genus3.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 540 records

Wild obs. + sensor1 470

Museum / vouchered1 070

Range

Area of Occupancy AOO4 904 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 493≤1 km 168≤10 km 146>10 km 32

839 georeferenced · 631 without coordinates

Open the mapobservation + sensor1 470

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy2% within 1 km

≤1 km 2≤10 km 58>10 km 26

86 georeferenced · 984 without coordinates

Open the institutions mapphysical evidence1 070

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
African Butterfly Research Institutelocation not on record	653
Teylers Museumlocation not on record	143
Durban Natural Science Museumlocation not on record	99
New Haven, US	42
Cambridge, US	35
DNSMlocation not on record	18
Iziko South African Museumlocation not on record	16
Cape Town, ZA	13
Sydney, AU	10
KwaZulu-Natal Museumlocation not on record	8
Natural History Museum Rotterdamlocation not on record	7
East London Museumlocation not on record	6
Northern Michigan Universitylocation not on record	5
Cleveland Museum of Natural History, OH (CLEV)location not on record	5
University of Johannesburglocation not on record	4
NTNU University Museum, Department of Natural Historylocation not on record	3
Natural History Museum of Utahlocation not on record	1
Blacksburg, US	1
MZLUlocation not on record	1

19 institutions · 1 070 of 1 070 vouchered records shown

09Environmental DNA26 detections

Where the DNA of Acraea neobule was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map6 countries0

Alluvial Plains

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 20.6–26.8

Seasonal swing summer↔winter7.40 °C

Max temp (day)27.2 °C 24.3–30.9

Min temp (night)18.5 °C 13.3–24.6

Precipitation83.5 mm/mo 41.3–244

Air humidity62.5 % 50.4–66.7

Moisture balance-64.3 mm/mo -100–96.7

Vapour deficit1,138 Pa 818–1,461

Wind speed2.90 m/s 1.80–3.50

Cloud cover34.1 % 17.6–63.8

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acraea neobule

At a glance

Sources8 archives

At a glance

Record type2 540 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 540 records