Acraea insignis

Distant, 1880 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Acraea

At a glance

Occurrence records502

Data sources7

Biological traits0

DNA specimens7

eDNA detections7

Sources7 archives

Databases and archives Acraea insignis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility502 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF502 records

Environmental DNA1 datasets · 3 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

Acraea insignis, the black-blotched acraea, is a butterfly in the family Nymphalidae. It is found in Ethiopia, the Democratic Republic of the Congo, Sudan, Uganda, Kenya, Tanzania, Malawi, Zambia, Mozambique and Zimbabwe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acraea insignis has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections7

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

63Avariable

73Gmostly conserved

78Cmostly conserved

96Avariable

97Gmostly conserved

261Cvariable

303Tvariable

321Gmostly conserved

424Tmostly conserved

519Cmostly conserved

538Cmostly conserved

624Avariable

642Cvariable

TTATATTTTATTTTTGGTATTTGATCTGGAATAATTGGAACATCTTTAAGCTTACTAATTCGAACAGAATTAGGTAACCCAGGATCTTTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.90%

Haplotypes6

BIN1

Most divergent pair1.5%

AfricaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acraea mahelasame genus3.2%Acraea neobulesame genus3.2%Acraea eltringhamisame genus3.8%Acraea hortasame genus4.3%Acraea andromachasame genus4.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type502 records

Wild obs. + sensor157

Museum / vouchered345

Range

Area of Occupancy AOO528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 18≤1 km 17≤10 km 6>10 km 3

44 georeferenced · 113 without coordinates

Open the mapobservation + sensor157

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤1 km 4≤10 km 36>10 km 14

54 georeferenced · 291 without coordinates

Open the institutions mapphysical evidence345

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
African Butterfly Research Institutelocation not on record	288
New Haven, US	34
Cambridge, US	18
National Museums of Kenyalocation not on record	2
Natural History Museum Rotterdamlocation not on record	1
MZLUlocation not on record	1
Museum national d'Histoire naturellelocation not on record	1

7 institutions · 345 of 345 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Acraea insignis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.9 °C 18.6–24.4

Seasonal swing summer↔winter4.70 °C

Max temp (day)27.2 °C 23.0–28.2

Min temp (night)18.5 °C 14.8–19.4

Precipitation121 mm/mo 69.7–251

Air humidity60.3 % 56.3–68.1

Moisture balance-41.9 mm/mo -58.7–117

Vapour deficit1,109 Pa 681–1,338

Wind speed1.80 m/s 0.9–2.40

Cloud cover40.8 % 40.1–49.4

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)