Acraea horta

Linnaeus, 1764 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Acraea

At a glance

Occurrence records5 287

Data sources8

Biological traits0

DNA specimens14

eDNA detections29

Sources8 archives

Databases and archives Acraea horta's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 287 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 287 records

Environmental DNA1 datasets · 1 countries29 detections

DNA & barcodingBOLD14 specimens

01Narrative

Acraea horta or the garden acraea is a butterfly of the family Nymphalidae. It is found in South Africa and Zimbabwe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acraea horta has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections29

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 3 variable positions, in barcode order

46Amostly conserved

82Tmostly conserved

421Gmostly conserved

AACTTTATATTTTATTTTTGGTATTTGATCTGGAATAATTGGAACATCTTTAAGCTTATTAATTCGAACAGAATTAGGTAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acraea eltringhamisame genus3.2%Acraea neobulesame genus3.5%Acraea mahelasame genus3.5%Acraea turlinisame genus3.6%Acraea insignissame genus4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type5 287 records

Wild obs. + sensor4 316

Museum / vouchered971

Range

Area of Occupancy AOO4 232 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 2 311≤1 km 571≤10 km 171>10 km 77

3 130 georeferenced · 1 186 without coordinates

Open the mapobservation + sensor4 316

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤100 m 2≤10 km 44>10 km 14

60 georeferenced · 911 without coordinates

Open the institutions mapphysical evidence971

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Teylers Museumlocation not on record	281
African Butterfly Research Institutelocation not on record	258
Durban Natural Science Museumlocation not on record	158
Sydney, AU	67
Iziko South African Museumlocation not on record	51
New Haven, US	38
Cape Town, ZA	38
DNSMlocation not on record	28
Northern Michigan Universitylocation not on record	13
Cambridge, US	9
KwaZulu-Natal Museumlocation not on record	9
Natural History Museum Rotterdamlocation not on record	8
East London Museumlocation not on record	8
Natural History Museum of Utahlocation not on record	2
MZLUlocation not on record	2
Auckland, NZ	1

16 institutions · 971 of 971 vouchered records shown

09Environmental DNA29 detections

Where the DNA of Acraea horta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map1 country0

4. Native Grassland|4.6. Subtropical/Tropica…4. Native Grassland | 4.5. Subtropical/Tropi…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 16.1–21.9

Seasonal swing summer↔winter10.8 °C

Max temp (day)25.0 °C 22.2–28.6

Min temp (night)14.9 °C 10.0–15.9

Precipitation79.1 mm/mo 46.4–132

Air humidity53.5 % 48.6–63.6

Moisture balance-54.9 mm/mo -106–-31.3

Vapour deficit974 Pa 825–1,308

Wind speed2.60 m/s 2.00–3.10

Cloud cover23.7 % 19.9–38.0

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acraea horta

At a glance

Sources8 archives

At a glance

Record type5 287 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 287 records