Acraea andromacha

Fabricius, 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Acraea

At a glance

Occurrence records2 851

Data sources8

Biological traits0

DNA specimens27

eDNA detections25

Sources8 archives

Databases and archives Acraea andromacha's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 851 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF2 851 records

Environmental DNA1 datasets · 2 countries25 detections

DNA & barcodingBOLD27 specimens

01Narrative

Acraea andromacha, the glasswing or small greasy, is a butterfly of the family Nymphalidae. It is found in Australia, New Guinea and surrounding islands. See the subspecies section for more details. The wingspan is about 60 mm. The larvae feed on Adenia heterophylla, Passiflora cinnabarina, Passiflora herbertiana, Passiflora foetida, Passiflora mollissima, Passiflora suberosa, Passiflora subpeltata, Hybanthus aurantiacus and Hybanthus enneaspermus. Larva Imago

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition4 compounds

Compounds documented for Acraea andromacha across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Carboline alkaloids4

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
4,9-Dihydro-1-methyl-3H-pyrido(3,4-b)indole	present	LOTUS
Harman	present	LOTUS
Harmine	present	LOTUS
Norharman	present	LOTUS

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acraea andromacha has left across the world's sequence archives.

At a glance

DNA specimens27

BINs1

Marker genes1

eDNA detections25

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

1Amostly conserved

295Tmostly conserved

574Tmostly conserved

AACTTTATATTTTATTTTTGGTATTTGATCTGGAATAATTGGAACATCTTTAAGTTTATTAATTCGAACAGAATTAGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.20%

Haplotypes3

BIN1

Most divergent pair0.30%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acraea neobulesame genus2.9%Acraea mahelasame genus2.9%Acraea eltringhamisame genus3.8%Acraea violaesame genus4.2%Acraea turlinisame genus4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 851 records

Wild obs. + sensor2 715

Museum / vouchered135

Other1

Range

Area of Occupancy AOO5 692 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 953≤1 km 452≤10 km 111>10 km 148

1 664 georeferenced · 1 051 without coordinates

Open the mapobservation + sensor2 715

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 7≤1 km 10≤10 km 46>10 km 38

101 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence135

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	32
Natick, US	18
New Haven, US	13
Australian National Fish Collectionlocation not on record	12
Natural History Museum Rotterdamlocation not on record	6
Tallinn, EE	5
MZLUlocation not on record	5
ZSMlocation not on record	4
Sydney, AU	4
DPIlocation not on record	2
Museum and Art Gallery of the Northern Territorylocation not on record	1
Durban Natural Science Museumlocation not on record	1
Natural History Museum of Utahlocation not on record	1
Australian National Insect Collectionlocation not on record	1
QVMAGlocation not on record	1
Research Collection of Graeme V. Cockslocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
Auckland, NZ	1
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	1

20 institutions · 111 of 135 vouchered records shown · 24 without an institution code

09Environmental DNA25 detections

Where the DNA of Acraea andromacha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map2 countries0

Open forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 19.1–29.3

Seasonal swing summer↔winter8.60 °C

Max temp (day)26.2 °C 24.4–33.8

Min temp (night)19.0 °C 14.2–24.2

Precipitation101 mm/mo 24.6–142

Air humidity59.4 % 54.5–62.6

Moisture balance-55.0 mm/mo -119–9.30

Vapour deficit1,137 Pa 893–1,682

Wind speed2.40 m/s 1.50–3.80

Cloud cover31.5 % 24.2–46.4

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acraea andromacha

At a glance

Sources8 archives

Compound class profile1 class

Documented compounds4 total

At a glance

Record type2 851 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 851 records