Acraea boopis

Wichgraf, 1914 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Acraea

At a glance

Occurrence records67

Data sources8

Biological traits0

DNA specimens4

eDNA detections1

Sources8 archives

Databases and archives Acraea boopis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility67 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF67 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD4 specimens

01Narrative

Acraea boopis, the rainforest acraea, is a butterfly of the family Nymphalidae. It is found in KwaZulu-Natal, Swaziland, from Mozambique to Kenya and in Tanzania. The wingspan is 45–52 mm for males and 49–58 mm for females. Adults are on wing year round, with peaks from November to March in southern Africa. The larvae feed on Celastraceae species, including Cassine tetragonal, Maytenus acuminate, Maytenus heterophylla and Rawsonia lucida.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acraea boopis has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.7%

Haplotypes2

BINs2

Most divergent pair2.6%

Where individuals differ — all 17 variable positions, in barcode order

49Avariable

82Cvariable

85Cvariable

127Tvariable

133Cvariable

220Tvariable

226Cvariable

266Cvariable

355Cvariable

376Tvariable

403Avariable

407Cvariable

463Tvariable

490Cvariable

517Tvariable

547Tvariable

616Cvariable

AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAATTGGAACATCATTAAGTTTATTAATTCGAACAGAATTAGGTAACCCCGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acraea leucographasame genus2.3%Acraea endoscotasame genus2.5%Acraea admathasame genus3.8%Acraea igatisame genus5.0%Acraea neobulesame genus5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type67 records

Wild obs. + sensor20

Museum / vouchered47

Range

Area of Occupancy AOO96 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 10≤1 km 4≤10 km 1

15 georeferenced · 5 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 47 records without

Open the institutions mapphysical evidence47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Durban Natural Science Museumlocation not on record	25
African Butterfly Research Institutelocation not on record	21
NTNU University Museum, Department of Natural Historylocation not on record	1

3 institutions · 47 of 47 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Acraea boopis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.1 °C 19.1–19.1

Seasonal swing summer↔winter7.40 °C

Max temp (day)23.1 °C

Min temp (night)14.9 °C

Precipitation66.3 mm/mo

Air humidity66.3 %

Moisture balance-60.7 mm/mo

Vapour deficit745 Pa

Wind speed3.80 m/s

Cloud cover52.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)