Acraea leucographa

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Acraea

At a glance

Occurrence records342

Data sources6

Biological traits0

DNA specimens6

eDNA detections6

Sources6 archives

Databases and archives Acraea leucographa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility342 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF342 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Acraea leucographa, the Ribbe's glassy acraea, is a butterfly of the family Nymphalidae. It is found in Ivory Coast, Ghana, Nigeria, Cameroon, Gabon, the Republic of the Congo, the Central African Republic, Angola, the southern part of the Democratic Republic of the Congo, Uganda, western Kenya, western Tanzania and north-western Zambia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acraea leucographa has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

31Gvariable

34Avariable

88Avariable

94Amostly conserved

100Amostly conserved

106Tvariable

109Avariable

133Tvariable

160Gvariable

163Cvariable

166Gvariable

175Amostly conserved

265Tmostly conserved

352Avariable

373Tvariable

401Cvariable

403Amostly conserved

407Cvariable

433Avariable

466Amostly conserved

490Tmostly conserved

508Cvariable

523Cvariable

619Amostly conserved

646Cvariable

AACTTTATATTTTATTTTTGGTATTTGATCGGGAATAATTGGAACATCATTAAGTTTATTAATTCGAACAGAATTAGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes5

BINs2

Most divergent pair3.0%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acraea boopissame genus2.3%Acraea endoscotasame genus3.1%Acraea admathasame genus5.5%Acraea eltringhamisame genus6.4%Acraea igatisame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type342 records

Wild obs. + sensor11

Museum / vouchered331

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 1≤1 km 2≤10 km 1>10 km 1

5 georeferenced · 6 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 10>10 km 3

13 georeferenced · 318 without coordinates

Open the institutions mapphysical evidence331

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
African Butterfly Research Institutelocation not on record	318
New Haven, US	10
Cambridge, US	3

3 institutions · 331 of 331 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Acraea leucographa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

Primary/seconday forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.7 °C 25.1–28.3

Seasonal swing summer↔winter3.20 °C

Max temp (day)30.8 °C 28.8–32.8

Min temp (night)23.7 °C 22.5–24.8

Precipitation152 mm/mo 60.3–244

Air humidity67.1 % 62.8–71.4

Moisture balance21.5 mm/mo -88.3–131

Vapour deficit1,174 Pa 916–1,432

Wind speed2.00 m/s 1.30–2.70

Cloud cover28.3 % 17.9–38.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)