Acraea endoscota

Le Doux, 1928 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Acraea

At a glance

Occurrence records257

Data sources7

Biological traits0

DNA specimens4

eDNA detections2

Sources7 archives

Databases and archives Acraea endoscota's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility257 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF257 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD4 specimens

01Narrative

Acraea endoscota, the Le Doux's glassy acraea, is a butterfly in the family Nymphalidae. It is found in Guinea, Sierra Leone, Ivory Coast, Ghana, Nigeria, Cameroon, Gabon, the Republic of the Congo, the Central African Republic, northern Angola, the Democratic Republic of the Congo (Mongala, Kivu, Kasai, Sankuru), Uganda, Rwanda, south-western Ethiopia, western Kenya and western Tanzania.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acraea endoscota has left across the world's sequence archives.

At a glance

DNA specimens4

BINs3

Marker genes1

eDNA detections2

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

40Avariable

46Cvariable

71Tvariable

100Cvariable

103Tvariable

115Tvariable

118Tvariable

163Avariable

178Avariable

197Gvariable

199Tvariable

232Tvariable

263Cvariable

352Cvariable

404Cvariable

409Cvariable

467Gvariable

505Gvariable

520Cvariable

544Cvariable

562Avariable

601Cvariable

610Cvariable

613Cvariable

643Cvariable

650Tvariable

TTTATATTTTATTTTTGGTATTTGATCAGGAATAATTGGAACATCCTTAAGTTTACTAATTCGAACAGAATTAGGTAACCCAGGATCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.7%

Haplotypes3

BINs3

Most divergent pair3.2%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acraea boopissame genus2.5%Acraea leucographasame genus3.1%Acraea admathasame genus5.5%Acraea andromachasame genus6.0%Acraea igatisame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type257 records

Wild obs. + sensor10

Museum / vouchered247

Range

Area of Occupancy AOO352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1≤1 km 3≤10 km 2>10 km 2

8 georeferenced · 2 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 1≤10 km 3

4 georeferenced · 243 without coordinates

Open the institutions mapphysical evidence247

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
African Butterfly Research Institutelocation not on record	240
MZLUlocation not on record	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	3

3 institutions · 247 of 247 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Acraea endoscota was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)