Acleris negundana

(Busck, 1940) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records72

Data sources8

Biological traits0

DNA specimens36

eDNA detections46

Sources8 archives

Databases and archives Acleris negundana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility72 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI46 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF72 records

Environmental DNA1 datasets · 2 countries46 detections

DNA & barcodingBOLD36 specimens

01Narrative

Acleris negundana, the speckled acleris moth, is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from the District of Columbia, Georgia, Illinois, Indiana, Kentucky, Maine, Manitoba, Maryland, Massachusetts, Minnesota, Mississippi, Missouri, Ohio, Ontario, Virginia, West Virginia and Wisconsin. The wingspan is 16–17 mm. Adults have been recorded on wing nearly year round.mothphotographersgroup The larvae feed on Acer negundo.Tortricidae Food Plant Database

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris negundana has left across the world's sequence archives.

At a glance

DNA specimens36

BINs2

Marker genes1

eDNA detections46

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 39 variable positions, in barcode order

4Amostly conserved

40Amostly conserved

82Cmostly conserved

94Amostly conserved

100Tmostly conserved

118Cmostly conserved

121Tmostly conserved

154Tmostly conserved

163Tmostly conserved

166Amostly conserved

190Tmostly conserved

199Gmostly conserved

217Amostly conserved

232Tmostly conserved

235Tmostly conserved

263Tmostly conserved

274Cmostly conserved

283Gmostly conserved

292Cmostly conserved

313Cmostly conserved

316Tmostly conserved

340Tmostly conserved

355Tmostly conserved

400Tmostly conserved

401Cmostly conserved

406Cmostly conserved

412Cmostly conserved

421Amostly conserved

448Tmostly conserved

460Cmostly conserved

490Cmostly conserved

541Tmostly conserved

547Tmostly conserved

562Amostly conserved

577Avariable

578Cmostly conserved

583Tmostly conserved

634Cmostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCCCTAAGATTATTAATTCGAGCAGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes6

BINs2

Most divergent pair5.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris subnivanasame genus4.7%Acleris implexanasame genus4.9%Acleris cervinanasame genus4.9%Acleris obtusanasame genus4.9%Acleris forbesanasame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type72 records

Wild obs. + sensor28

Museum / vouchered44

Range

Area of Occupancy AOO188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 12≤1 km 5≤10 km 1>10 km 3

21 georeferenced · 7 without coordinates

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4>10 km 2

6 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	11
St. Paul, US	9
East Lansing, US	5
Mississippi State, US	3
New Haven, US	1

5 institutions · 29 of 44 vouchered records shown · 15 without an institution code

09Environmental DNA46 detections

Where the DNA of Acleris negundana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found46

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 46 detections have coordinates

Open the map2 countries0

PrairieForest1. Forest & Woodland|1.4. Temperate ForestTemperate mixed forestGrasslandMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 5.60–23.0

Seasonal swing summer↔winter26.3 °C

Max temp (day)18.5 °C 9.90–27.2

Min temp (night)8.20 °C 0.2–18.2

Precipitation91.2 mm/mo 72.2–110

Air humidity57.0 % 53.7–58.5

Moisture balance-28.4 mm/mo -66.3–25.1

Vapour deficit658 Pa 409–1,182

Wind speed3.40 m/s 2.70–4.70

Cloud cover45.1 % 35.2–48.9

CHELSA 1981–2010, ~9 km grid, at location & month of 42 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)