Acleris hudsoniana

(Walker, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records105

Data sources7

Biological traits0

DNA specimens20

eDNA detections0

Sources7 archives

Databases and archives Acleris hudsoniana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility105 records↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF105 records

DNA & barcodingBOLD20 specimens

01Narrative

Acleris hudsoniana is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Alaska, Alberta, Indiana, Maine, Manitoba, Massachusetts, Michigan, New Hampshire, New Jersey, Ontario, Saskatchewan, West Virginia and Wisconsin.mothphotographersgroupMcDunnough, J. 1934. The Canadian species of the Tortricid genus Peronea. Canadian Journal of Research, 1934, 11(3): 290–332 The wingspan is 16–20 mm. Adults have been recorded on wing from March to April and from September to November. The larvae feed on Betula papyrifera, Picea glauca, Populus balsamifera, Populus tremuloides, Alnus and Salix species.Tortricidae Food Plant Database

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris hudsoniana has left across the world's sequence archives.

At a glance

DNA specimens20

BINs3

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 66 variable positions, in barcode order

13Tmostly conserved

22Amostly conserved

34Tmostly conserved

40Gmostly conserved

46Tmostly conserved

49Tmostly conserved

56Tmostly conserved

82Cmostly conserved

85Tmostly conserved

91Amostly conserved

100Tmostly conserved

106Tmostly conserved

115Tmostly conserved

121Cmostly conserved

142Tmostly conserved

163Gmostly conserved

169Avariable

181Tmostly conserved

190Amostly conserved

205Tmostly conserved

226Cmostly conserved

235Cmostly conserved

241Tmostly conserved

256Tmostly conserved

266Cvariable

268Amostly conserved

274Tmostly conserved

277Cmostly conserved

280Cmostly conserved

286Tmostly conserved

304Tmostly conserved

307Gmostly conserved

319Amostly conserved

325Amostly conserved

340Cmostly conserved

367Tvariable

370Tmostly conserved

385Tmostly conserved

397Tmostly conserved

400Amostly conserved

406Cmostly conserved

415Amostly conserved

418Tmostly conserved

421Amostly conserved

442Cmostly conserved

451Cmostly conserved

460Cmostly conserved

463Cmostly conserved

472Tmostly conserved

482Tmostly conserved

493Avariable

499Amostly conserved

508Gmostly conserved

541Amostly conserved

553Amostly conserved

562Amostly conserved

578Tmostly conserved

581Cmostly conserved

604Tmostly conserved

607Amostly conserved

616Cmostly conserved

622Amostly conserved

628Amostly conserved

631Amostly conserved

646Cmostly conserved

652Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTGGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes14

BINs3

Most divergent pair7.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris lacordairanasame genus5.2%Acleris cervinanasame genus5.5%Acleris forbesanasame genus5.6%Acleris braunanasame genus5.6%Acleris ptychogrammossame genus5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type105 records

Wild obs. + sensor46

Museum / vouchered59

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 36≤1 km 4≤10 km 2

42 georeferenced · 4 without coordinates

Open the mapobservation + sensor46

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤1 km 3≤10 km 4>10 km 1

8 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence59

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	44
East Lansing, US	7
St. Paul, US	6
Edmonton, CA	1
Cornell University Insect Collectionlocation not on record	1

5 institutions · 59 of 59 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)