Acleris ferrugana

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records3 031

Data sources9

Biological traits2

DNA specimens67

eDNA detections114

Sources9 archives

Databases and archives Acleris ferrugana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 031 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI114 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics67 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 031 records

Environmental DNA3 datasets · 12 countries114 detections

DNA & barcodingBOLD67 specimens

Genome at a glanceGoaT · NCBI≈480 Mbp

01Narrative

Acleris ferrugana is a species of moth of the family Tortricidae. It is found in China,Check List of the Tribe Tortricini (Lepidoptera: Tortricidae) in Northeast china, with Two Newly Recorded Species from China most of Europe and has also been recorded from North America.mothphotographersgroup Larva Larva feeding beneath webbing The wingspan is 14–18 mm. It is a very variable species. Some forms are very similar to Acleris notana and the two can only separated by examination of the genitalia.Julius von Kennel provides a full description.Julius von Kennel, 1921, The Palaearktischen Tortriciden, eine monographische Darstellung. Stuttgart: E. Schweizerbart'sche Verlagsbuchhandlung. 742 pp. - Palaearctic Tortricidae, a monograph.pdf at Zobodat 93-94 Adults are on wing in July and again in September and October. The second generation overwinters and reappears in spring.UKmoths The larvae feed on Quercus species. They feed from within a spinning between the leaves of their host plant.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding67 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris ferrugana has left across the world's sequence archives.

At a glance

DNA specimens67

BINs2

Marker genes1

eDNA detections114

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus59 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

67Gmostly conserved

197Cvariable

208Amostly conserved

313Cmostly conserved

577Gmostly conserved

604Tmostly conserved

616Cmostly conserved

631Gvariable

AACATTATATTTTATTTTTGGAATTTGGGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGGGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.55%

Haplotypes16

BINs2

Most divergent pair4.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris notanasame genus4.3%Acleris cervinanasame genus4.4%Acleris cornanasame genus4.4%Acleris braunanasame genus4.6%Acleris implexanasame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acleris ferrugana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈480 025 470 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acleris ferrugana0.48 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.2% BUSCO

08Occurrence & distribution

Record type3 031 records

Wild obs. + sensor2 305

Museum / vouchered652

Other74

Origin

Native2

Range

Area of Occupancy AOO5 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 860≤1 km 668≤10 km 660>10 km 3

2 191 georeferenced · 114 without coordinates

Open the mapobservation + sensor2 305

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 198≤1 km 191≤10 km 128>10 km 2

519 georeferenced · 133 without coordinates

Open the institutions mapphysical evidence652

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	233
NHMOlocation not on record	75
Provincia di Livornolocation not on record	49
Tartu, EE	42
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	30
Nijmegen, NL	26
SLU Artdatabankenlocation not on record	24
Salzburg, AT	20
Natural History Museum Rotterdamlocation not on record	18
DABUHlocation not on record	17
Metsähallituslocation not on record	15
NTNU-VMlocation not on record	14
Durban Natural Science Museumlocation not on record	8
Washington, US	8
Philadelphia, US	5
Tromsø, NO	4
Stockholm, SE	4
Tallinn, EE	4
neflocation not on record	4
ZSMlocation not on record	3
South Kensington, GB	3
European Distributed Institute of Taxonomy (EDIT)location not on record	2
Bavarian State Collection of Zoologylocation not on record	2
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	2
Kuopio, FI	2
University of Kaiserslauternlocation not on record	1
Natural History Museum, Londonlocation not on record	1
NTNU University Museum, Department of Natural Historylocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1

29 institutions · 618 of 652 vouchered records shown · 34 without an institution code

09Environmental DNA114 detections

Where the DNA of Acleris ferrugana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found114

Studies independent surveys3

Countries12

Verifiable raw sequence linked37

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 114 detections have coordinates

Open the map12 countries0

Quercus roburFloodplain forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.60 °C 2.50–18.0

Seasonal swing summer↔winter16.9 °C

Max temp (day)12.0 °C 5.40–22.2

Min temp (night)4.80 °C -0.4–13.7

Precipitation63.9 mm/mo 41.2–111

Air humidity64.0 % 58.0–68.7

Moisture balance3.90 mm/mo -55.9–76.0

Vapour deficit378 Pa 248–867

Wind speed3.60 m/s 2.50–5.00

Cloud cover46.9 % 32.8–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 109 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acleris ferrugana

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 031 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 031 records