Acleris effractana

(Hübner, 1799) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records2 568

Data sources9

Biological traits2

DNA specimens27

eDNA detections1

Sources9 archives

Databases and archives Acleris effractana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 568 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 568 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD27 specimens

Genome at a glanceNCBI≈687 Mbp

01Narrative

Acleris effractana, the hook-winged tortrix moth, is a moth of the family Tortricidae. It was described by Jacob Hübner in 1799. It has a Holarctic distribution. In Europe, it is found from northern Europe to the northern part of central Europe.Fauna Europaea It is also present in north-western Russia, Japan, Canada and the northwestern United States. The wingspan is 21–23 mm. The forewings are brownish fuscous with thin lines and groups of blackish erect scales. The hindwings are light grey. It is very similar to Acleris emargana. The larvae feed on Salix pentandra, Salix purpurea and Salix cinerea. They live between leaves spun together in the terminal shoots of their host plant. The larvae are bluish green. Larvae can be found from June to the beginning of October.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris effractana has left across the world's sequence archives.

At a glance

DNA specimens27

BINs2

Marker genes1

eDNA detections1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 39 variable positions, in barcode order

40Amostly conserved

50Tmostly conserved

52Gvariable

100Tvariable

136Tmostly conserved

169Cmostly conserved

172Cvariable

178Tmostly conserved

214Avariable

220Cmostly conserved

232Cmostly conserved

271Cmostly conserved

274Cmostly conserved

313Cmostly conserved

316Gvariable

364Cmostly conserved

370Amostly conserved

401Tvariable

403Avariable

412Avariable

421Tmostly conserved

448Tmostly conserved

463Tvariable

478Tvariable

484Tmostly conserved

490Cmostly conserved

508Amostly conserved

511Avariable

517Tmostly conserved

526Amostly conserved

533Tmostly conserved

539Tmostly conserved

542Cmostly conserved

562Avariable

581Tmostly conserved

616Cvariable

622Amostly conserved

628Amostly conserved

641Tvariable

AACATTATATTTCATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCTTTGAGATTATTAATTCGAGCAGAACTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes10

BINs2

Most divergent pair4.7%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris emarganasame genus3.6%Acleris varianasame genus6.5%Acleris hyemanasame genus6.5%Acleris caliginosanasame genus6.5%Acleris kochiellasame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceNCBI

The complete instruction manual Acleris effractana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈686 944 170 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acleris effractana0.69 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type2 568 records

Wild obs. + sensor2 263

Museum / vouchered305

Range

Area of Occupancy AOO2 188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 1 602≤1 km 323≤10 km 274>10 km 9

2 208 georeferenced · 55 without coordinates

Open the mapobservation + sensor2 263

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 135≤1 km 78≤10 km 24

237 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence305

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	59
NHMOlocation not on record	58
NTNU-VMlocation not on record	50
University of Alberta Museums (UAM)location not on record	31
Edmonton, CA	31
Kuopio, FI	12
Tartu, EE	8
Metsähallituslocation not on record	4
Research Collection of Kai Berggrenlocation not on record	4
SLU Artdatabankenlocation not on record	4
South Kensington, GB	3
KWPlocation not on record	2
Cornell University Insect Collectionlocation not on record	1
University of Alaska Museumlocation not on record	1
ZMAAlocation not on record	1

15 institutions · 269 of 305 vouchered records shown · 36 without an institution code

09Environmental DNA1 detections

Where the DNA of Acleris effractana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.8 °C 13.8–13.8

Seasonal swing summer↔winter37.5 °C

Max temp (day)18.5 °C

Min temp (night)9.90 °C

Precipitation83.8 mm/mo

Air humidity57.7 %

Moisture balance14.0 mm/mo

Vapour deficit669 Pa

Wind speed1.30 m/s

Cloud cover65.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acleris effractana

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 568 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 568 records