Acleris emargana

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records6 550

Data sources10

Biological traits2

DNA specimens80

eDNA detections52

Sources10 archives

Databases and archives Acleris emargana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 550 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI52 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics80 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF6 550 records

Environmental DNA1 datasets · 7 countries52 detections

DNA & barcodingBOLD80 specimens

Genome at a glanceGoaT · NCBI≈691 Mbp

01Narrative

Acleris emargana, the notched-winged tortricid, is a moth of the family Tortricidae. The species was first described by Johan Christian Fabricius in 1775.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding80 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris emargana has left across the world's sequence archives.

At a glance

DNA specimens80

BINs5

Marker genes1

eDNA detections52

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus73 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 41 variable positions, in barcode order

40Amostly conserved

50Cmostly conserved

52Amostly conserved

99Gmostly conserved

103Cvariable

136Tmostly conserved

160Gvariable

169Tmostly conserved

172Tmostly conserved

178Tmostly conserved

199Amostly conserved

214Amostly conserved

220Tmostly conserved

232Tmostly conserved

274Cmostly conserved

307Gvariable

313Tmostly conserved

316Gmostly conserved

364Tmostly conserved

370Tmostly conserved

388Gvariable

400Cvariable

401Tmostly conserved

403Amostly conserved

412Tmostly conserved

421Tmostly conserved

448Cmostly conserved

466Gvariable

478Tmostly conserved

484Cmostly conserved

490Tmostly conserved

508Amostly conserved

517Amostly conserved

526Amostly conserved

533Cmostly conserved

542Cmostly conserved

562Amostly conserved

577Gvariable

581Cmostly conserved

607Tmostly conserved

616Cmostly conserved

AACATTATATTTCATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCTCTAAGATTATTAATTCGAGCAGAACTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes15

BINs4

Most divergent pair4.9%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris effractanasame genus3.6%Acleris hyemanasame genus6.1%Acleris kochiellasame genus6.7%Acleris nivisellanasame genus7.3%Acleris cervinanasame genus7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acleris emargana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈691 431 929 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acleris emargana0.69 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.8% BUSCO

08Occurrence & distribution

Record type6 550 records

Wild obs. + sensor5 495

Museum / vouchered965

Other90

Origin

Native29

Range

Area of Occupancy AOO9 744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 2 270≤1 km 1 128≤10 km 1 824>10 km 5

5 227 georeferenced · 268 without coordinates

Open the mapobservation + sensor5 495

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 361≤1 km 305≤10 km 136>10 km 2

804 georeferenced · 161 without coordinates

Open the institutions mapphysical evidence965

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	276
NHMOlocation not on record	125
Tartu, EE	101
Kuopio, FI	68
Provincia di Livornolocation not on record	50
NTNU-VMlocation not on record	37
SLU Artdatabankenlocation not on record	28
RMZlocation not on record	25
University of Alberta Museums (UAM)location not on record	22
Rovaniemi, FI	15
Tallinn, EE	14
Philadelphia, US	13
Tromsø, NO	12
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	11
DABUHlocation not on record	10
Salzburg, AT	8
Nijmegen, NL	8
Natural History Museum Rotterdamlocation not on record	6
Durban Natural Science Museumlocation not on record	6
ZMAAlocation not on record	5
neflocation not on record	5
Stockholm, SE	5
St. Paul, US	5
South Kensington, GB	3
KIRMlocation not on record	3
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	2
NMBU:MINAlocation not on record	2
University of Kaiserslauternlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Research Collection of Kai Berggrenlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
NTNU University Museum, Department of Natural Historylocation not on record	1
Edmonton, CA	1
Trondheim, NO	1
Naturalis Biodiversity Centerlocation not on record	1

36 institutions · 875 of 965 vouchered records shown · 90 without an institution code

09Environmental DNA52 detections

Where the DNA of Acleris emargana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found52

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 52 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.9 °C 4.50–17.5

Seasonal swing summer↔winter20.2 °C

Max temp (day)14.5 °C 7.30–21.2

Min temp (night)6.80 °C 1.50–13.8

Precipitation77.6 mm/mo 58.4–165

Air humidity63.4 % 59.7–65.8

Moisture balance9.70 mm/mo -27.6–71.0

Vapour deficit469 Pa 375–777

Wind speed2.70 m/s 2.30–4.30

Cloud cover47.1 % 36.3–54.6

CHELSA 1981–2010, ~9 km grid, at location & month of 51 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acleris emargana

At a glance

Sources10 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type6 550 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 550 records