Acleris affinatana

(Snellen, 1883) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records155

Data sources7

Biological traits0

DNA specimens7

eDNA detections0

Sources7 archives

Databases and archives Acleris affinatana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility155 records↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF155 records

DNA & barcodingBOLD7 specimens

01Narrative

Acleris affinatana is a species of moth of the family Tortricidae. It is found in South Korea, North Korea, China, Japan and Russia (Siberia, Amur). The wingspan is about 18 mm. The larvae feed on Quercus dentata, Quercus serrata, Quercus acutissima and Zelkovia scheideriana.Check List of the Tribe Tortricini (Lepidoptera: Tortricidae) in Northeast china, with Two Newly Recorded Species from China

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris affinatana has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P610 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Diversity (π)1.8%

Haplotypes2

BINs2

Most divergent pair6.2%

Where individuals differ — all 39 variable positions, in barcode order

33Tmostly conserved

34Amostly conserved

40Gmostly conserved

43Tmostly conserved

52Tmostly conserved

67Cmostly conserved

85Cmostly conserved

91Amostly conserved

112Gmostly conserved

169Amostly conserved

175Amostly conserved

187Tmostly conserved

214Amostly conserved

239Tmostly conserved

265Cmostly conserved

286Amostly conserved

292Tmostly conserved

316Tmostly conserved

325Amostly conserved

328Amostly conserved

352Amostly conserved

353Tmostly conserved

367Amostly conserved

376Amostly conserved

388Amostly conserved

403Tmostly conserved

406Amostly conserved

412Tmostly conserved

451Cmostly conserved

466Amostly conserved

493Tmostly conserved

505Amostly conserved

541Cmostly conserved

556Tmostly conserved

562Cmostly conserved

571Tmostly conserved

589Tmostly conserved

593Cmostly conserved

595Tmostly conserved

TTTAAGATTATTAATCCGAGCAGAATTAGGAATACCTGGGTCTTTAATTGGTGATGATCAAATTTACAATACTATTGTAACAGCCCATGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris maximanasame genus5.1%Acleris literanasame genus5.7%Acleris ptychogrammossame genus5.7%Acleris umbranasame genus5.9%Acleris logianasame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type155 records

Wild obs. + sensor110

Museum / vouchered45

Range

Area of Occupancy AOO392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 3≤1 km 19≤10 km 1

23 georeferenced · 87 without coordinates

Open the mapobservation + sensor110

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 5

5 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence45

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chiba, JP	15
Kawasaki Shi Tama Ku, JP	14
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	7
Iwate Prefectural Museumlocation not on record	5
National Institute of Biological Resourceslocation not on record	3

5 institutions · 44 of 45 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)