Acanthodoris pilosa

(Abildgaard, 1789) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Onchidorididae/Acanthodoris

At a glance

Occurrence records4 738

Data sources9

Biological traits6

DNA specimens72

eDNA detections279

Sources9 archives

Databases and archives Acanthodoris pilosa's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 089 records↗

OBISOcean Biodiversity Information System1 649 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI279 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics72 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS4 738 records

Environmental DNA2 datasets · 7 countries279 detections

DNA & barcodingBOLD72 specimens

01Narrative

Acanthodoris pilosa is a species of sea slug, a dorid nudibranch, a shell-less marine gastropod mollusc in the family Onchidorididae. It is found in shallow water in the northeastern Atlantic Ocean, its range extending from Norway to France, and also both on the eastern coast of Canada and the United States, and the Pacific coast from the Aleutian Islands to Morro Bay, California.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length2 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits3

Depth max55 m

Depth min0 m

Vulnerability10

05DNA & barcoding72 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthodoris pilosa has left across the world's sequence archives.

At a glance

DNA specimens72

BINs3

Marker genes3

eDNA detections279

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus59 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 37 variable positions, in barcode order

56Tmostly conserved

103Tmostly conserved

109Tmostly conserved

115Tmostly conserved

205Tmostly conserved

226Cmostly conserved

229Amostly conserved

241Gmostly conserved

268Amostly conserved

271Amostly conserved

284Cmostly conserved

290Tmostly conserved

316Gmostly conserved

319Amostly conserved

322Amostly conserved

328Tvariable

343Amostly conserved

346Cmostly conserved

355Gmostly conserved

367Tmostly conserved

400Tmostly conserved

427Avariable

439Tmostly conserved

472Tmostly conserved

475Amostly conserved

484Amostly conserved

500Cmostly conserved

505Tmostly conserved

539Tmostly conserved

544Gmostly conserved

550Gmostly conserved

556Amostly conserved

562Gmostly conserved

571Tmostly conserved

610Cmostly conserved

652Cmostly conserved

658Cmostly conserved

AACATTATATATCATTTTTGGTATATGATGTGGACTTTTAGGAACTGGATTAAGATTATTAATTCGGTTCGAGCTTGGGACAGCGGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes12

BINs3

Most divergent pair13.1%

EuropeN.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthodoris atrogriseatasame genus4.4%Acanthodoris luteasame genus8.2%Acanthodoris hudsonisame genus10.1%Acanthodoris brunneasame genus10.2%Acanthodoris rhodocerassame genus10.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type4 738 records

Wild obs. + sensor2 629

Museum / vouchered1 829

Other280

Range

Area of Occupancy AOO6 152 km²

Depth

0–200 m sunlit1 024

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 16 m · max 183.1 m · 1 024 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 1 936≤1 km 151≤10 km 152>10 km 26

2 265 georeferenced · 364 without coordinates

Open the mapobservation + sensor2 629

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 172≤1 km 54≤10 km 56>10 km 10

292 georeferenced · 1 537 without coordinates

Open the institutions mapphysical evidence1 829

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	125
CEFASlocation not on record	70
DASSHlocation not on record	50
Gothenburg, SE	37
PNHSlocation not on record	21
Bergen, NO	19
New Haven, US	17
CASlocation not on record	13
730location not on record	11
SLU Artdatabankenlocation not on record	10
Victoria, CA	9
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	6
Baltic Sea Research Institute Warnemündelocation not on record	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Maurice Lamontagne Institutelocation not on record	4
Institut Francais pour l'Etude de la Merlocation not on record	4
Tromsø, NO	3
Natural History Museum Rotterdamlocation not on record	3
486location not on record	2
Edmonton, CA	2
Goteborg Natural History Museumlocation not on record	2
Norwegian Institute of Marine Researchlocation not on record	2
Santa Barbara Museum of Natural Historylocation not on record	1
Citadel Hill, GB	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Natural History Museum, Londonlocation not on record	1
Research Institute for Agriculture, Fisheries and Food (ILVO)location not on record	1
South Kensington, GB	1

28 institutions · 425 of 1 829 vouchered records shown · 10 without an institution code

09Environmental DNA279 detections

Where the DNA of Acanthodoris pilosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found279

Studies independent surveys2

Countries7

Verifiable raw sequence linked215

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 279 detections have coordinates

Open the map7 countries0

Hard substrateAlgae (Fucus serratus)RockStone, gravel, clayrocky shore/estuary

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 3.20–17.2

Seasonal swing summer↔winter23.4 °C

Max temp (day)16.7 °C 3.60–21.1

Min temp (night)11.7 °C -0.9–14.6

Precipitation110 mm/mo 73.3–127

Air humidity63.2 % 60.3–65.0

Moisture balance38.8 mm/mo -11.5–92.2

Vapour deficit587 Pa 266–689

Wind speed2.10 m/s 1.80–6.00

Cloud cover56.1 % 51.5–65.9

CHELSA 1981–2010, ~9 km grid, at location & month of 252 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acanthodoris pilosa

At a glance

Sources9 archives

Size & morphology1

Habitat & environment2

Other traits3

At a glance

Record type4 738 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 738 records