Acanthodoris hudsoni

MacFarland, 1905 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Onchidorididae/Acanthodoris

At a glance

Occurrence records741

Data sources8

Biological traits4

DNA specimens9

eDNA detections8

Sources8 archives

Databases and archives Acanthodoris hudsoni's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility673 records↗

OBISOcean Biodiversity Information System68 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS741 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD9 specimens

01Narrative

Acanthodoris hudsoni is a species of sea slug, a dorid nudibranch, a shell-less marine gastropod mollusc in the family Onchidorididae.Rosenberg, G. (2015). Acanthodoris hudsoni MacFarland, 1905. In: MolluscaBase (2015). Accessed through: World Register of Marine Species on 2016-01-09. Acanthodoris hudsoni

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length2 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Vulnerability10

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthodoris hudsoni has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes2

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACATTATATATCATTTTTGGTATGTGATGTGGACTTTTAGGAACTGGATTAAGACTACTAATTCGGTTTGAGCTTGGGACAGCAGGTGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthodoris luteasame genus8.5%Acanthodoris brunneasame genus10.1%Acanthodoris pilosasame genus10.1%Acanthodoris atrogriseatasame genus10.5%Acanthodoris pinasame genus11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type741 records

Wild obs. + sensor685

Museum / vouchered56

Range

Area of Occupancy AOO1 088 km²

Depth

0–200 m sunlit8

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 4.6 m · max 15 m · 8 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 335≤1 km 232≤10 km 32>10 km 31

630 georeferenced · 55 without coordinates

Open the mapobservation + sensor685

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 14≤10 km 10>10 km 4

28 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	19
Victoria, CA	10
Santa Barbara Museum of Natural Historylocation not on record	2
Centre for Biodiversity Genomicslocation not on record	1
Royal British Columbia Museumlocation not on record	1
Philadelphia, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1

7 institutions · 35 of 56 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Acanthodoris hudsoni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

rocky reef

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.4 °C 10.2–12.6

Seasonal swing summer↔winter14.7 °C

Max temp (day)15.2 °C 13.4–17.0

Min temp (night)7.60 °C 6.80–8.40

Precipitation76.6 mm/mo 74.4–78.8

Air humidity58.8 % 58.5–59.1

Vapour deficit558 Pa 517–598

Cloud cover44.4 % 43.8–45.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)