Acanthodoris atrogriseata

O'Donoghue, 1927 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Onchidorididae/Acanthodoris

At a glance

Occurrence records183

Data sources8

Biological traits2

DNA specimens12

eDNA detections21

Sources8 archives

Databases and archives Acanthodoris atrogriseata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility154 records↗

OBISOcean Biodiversity Information System29 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS183 records

Environmental DNA1 datasets · 2 countries21 detections

DNA & barcodingBOLD12 specimens

01Narrative

Acanthodoris atrogriseata is a species of sea slug, a dorid nudibranch, a shell-less marine gastropod mollusc in the family Onchidorididae.Rosenberg, G. (2015). Acanthodoris atrogriseata O'Donoghue, 1927. In: MolluscaBase (2015). Accessed through: World Register of Marine Species on 2016-01-11.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthodoris atrogriseata has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes2

eDNA detections21

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

115Cvariable

211Amostly conserved

271Amostly conserved

322Gmostly conserved

475Amostly conserved

529Cmostly conserved

542Cmostly conserved

544Amostly conserved

547Amostly conserved

571Cmostly conserved

610Cmostly conserved

613Tmostly conserved

634Cmostly conserved

AACATTATATATCATTTTTGGTATATGATGTGGACTTTTAGGAACTGGATTAAGATTATTAATTCGGTTCGAGCTTGGGACAGCGGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.46%

Haplotypes4

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthodoris pilosasame genus4.4%Acanthodoris luteasame genus9.3%Acanthodoris nanaimoensissame genus10.1%Acanthodoris brunneasame genus10.2%Acanthodoris hudsonisame genus10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type183 records

Wild obs. + sensor153

Museum / vouchered30

Range

Area of Occupancy AOO368 km²

Depth

0–200 m sunlit16

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 10 m · max 19.8 m · 16 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 77≤1 km 35≤10 km 28>10 km 12

152 georeferenced · 1 without coordinates

Open the mapobservation + sensor153

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	8
CASlocation not on record	7

2 institutions · 15 of 30 vouchered records shown

09Environmental DNA21 detections

Where the DNA of Acanthodoris atrogriseata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map2 countries0

Rock Scarp/Wallbedrock wallcreek mouthseagrass bed

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.8 °C 9.50–14.6

Seasonal swing summer↔winter10.4 °C

Max temp (day)17.1 °C 13.4–17.2

Min temp (night)11.5 °C 5.10–12.6

Precipitation148 mm/mo 138–194

Air humidity68.2 % 64.9–69.7

Moisture balance44.0 mm/mo 35.0–101

Vapour deficit501 Pa 417–502

Wind speed4.30 m/s 1.50–4.30

Cloud cover38.1 % 36.7–41.3

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)