Acanthodoris nanaimoensis

O'Donoghue, 1921 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Onchidorididae/Acanthodoris

At a glance

Occurrence records2 461

Data sources11

Biological traits4

DNA specimens17

eDNA detections17

Sources11 archives

Databases and archives Acanthodoris nanaimoensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 356 records↗

OBISOcean Biodiversity Information System105 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Chemical compositionLOTUS · NPASS48 compounds

Occurrence & distributionGBIF · OBIS2 461 records

Environmental DNA1 datasets · 2 countries17 detections

DNA & barcodingBOLD17 specimens

01Narrative

Acanthodoris nanaimoensis Acanthodoris nanaimoensis, the Nanaimo horned dorid, is a species of dorid nudibranch, a shell-less marine gastropod mollusc in the family Onchidorididae.Bouchet, P. (2015). Acanthodoris nanaimoensis O’Donoghue, 1921. In: MolluscaBase (2015). Accessed through: World Register of Marine Species on 2016-01-11.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length2.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Vulnerability10

03Chemical composition48 compounds

Compounds documented for Acanthodoris nanaimoensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Drimane sesquiterpenoids3

Longipinane sesquiterpenoids3

Longifolane sesquiterpenoids2

Himachalane sesquiterpenoids2

Cadinane sesquiterpenoids $ Zizaane sesquiterpenoids2

Documented compounds48 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Epicubenol	present	NPASS
(+)-tau-Muurolol	present	NPASS
(1R,3aS,4R,8aR)-Decahydro-4,8,8-trimethyl-9-methylene-1,4-methanoazulene	present	NPASS
(1S,2R,7S,8R,9R,10R)-2,6,6,9-tetramethyltetracyclo[5.4.0.02,9.08,10]undecane	present	NPASS
(1S,2R,7S,8S)-2,6,6-trimethyl-9-methylidenetricyclo[5.4.0.02,8]undecane	present	NPASS
(1S,6R)-alpha-himachalene	present	NPASS
(1S,6S)-alpha-himachalene	present	NPASS
(1S,6S,9R,10R)-5,5,9-trimethyltricyclo[7.1.1.01,6]undecane-10-carbaldehyde	present	LOTUS
(3S,4aS,8aR)-5,8a-dimethyl-3-prop-1-en-2-yl-2,3,4,4a,7,8-hexahydro-1H-naphthalene	present	NPASS
1,10-Di-epcubenol	present	NPASS

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthodoris nanaimoensis has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes2

eDNA detections17

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

59Tmostly conserved

67Gmostly conserved

88Tmostly conserved

109Cmostly conserved

163Gvariable

170Tmostly conserved

172Amostly conserved

206Tmostly conserved

214Tmostly conserved

220Amostly conserved

229Gmostly conserved

271Amostly conserved

283Tmostly conserved

292Amostly conserved

337Amostly conserved

343Tmostly conserved

484Gmostly conserved

518Cmostly conserved

526Amostly conserved

544Gmostly conserved

556Tmostly conserved

565Amostly conserved

568Cmostly conserved

592Amostly conserved

637Tmostly conserved

640Cmostly conserved

641Cvariable

AACATTATATATTATTTTTGGTATATGATGTGGACTTTTAGGAACTGGATTAAGATTATTAATTCGGTTTGAGCTTGGAACAGCAGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.87%

Haplotypes11

BIN1

Most divergent pair1.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthodoris brunneasame genus7.6%Acanthodoris luteasame genus8.1%Acanthodoris atrogriseatasame genus10.1%Acanthodoris rhodocerassame genus10.1%Acanthodoris pinasame genus10.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type2 461 records

Wild obs. + sensor2 346

Museum / vouchered115

Range

Area of Occupancy AOO2 412 km²

Depth

0–200 m sunlit4

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 14.1 m · max 56.7 m · 4 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 1 156≤1 km 595≤10 km 102>10 km 218

2 071 georeferenced · 275 without coordinates

Open the mapobservation + sensor2 346

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 2≤1 km 40≤10 km 8>10 km 12

62 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence115

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	33
Victoria, CA	23
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	9
Washington, US	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1

5 institutions · 68 of 115 vouchered records shown · 3 without an institution code

09Environmental DNA17 detections

Where the DNA of Acanthodoris nanaimoensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map2 countries0

rock outcrop, urchin barren, bedrock, expose…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 8.70–14.1

Seasonal swing summer↔winter9.50 °C

Max temp (day)13.1 °C 9.90–16.4

Min temp (night)10.7 °C 6.70–12.1

Precipitation151 mm/mo 73.8–151

Air humidity67.6 % 63.0–67.6

Vapour deficit448 Pa 391–507

Cloud cover39.9 % 37.6–42.5

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acanthodoris nanaimoensis

At a glance

Sources11 archives

Size & morphology1

Habitat & environment2

Other traits1

Compound class profile5 classes

Documented compounds48 total

At a glance

Record type2 461 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 5 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 461 records