Acanthodoris rhodoceras

Cockerell, 1905 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Onchidorididae/Acanthodoris

At a glance

Occurrence records1 966

Data sources7

Biological traits4

DNA specimens7

eDNA detections8

Sources7 archives

Databases and archives Acanthodoris rhodoceras's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 892 records↗

OBISOcean Biodiversity Information System74 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS1 966 records

Environmental DNA2 datasets · 1 countries8 detections

DNA & barcodingBOLD7 specimens

01Narrative

Acanthodoris rhodoceras is a species of sea slug, a dorid nudibranch, a shell-less marine gastropod mollusc in the family Onchidorididae.Bouchet, P. (2015). Acanthodoris rhodoceras Cockerell & Eliot, 1905. In: MolluscaBase (2015). Accessed through: World Register of Marine Species on 2016-01-11.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length2.8 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Vulnerability10

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthodoris rhodoceras has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes2

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P659 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.56%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 11 variable positions, in barcode order

103Cmostly conserved

190Amostly conserved

238Gmostly conserved

256Amostly conserved

290Tmostly conserved

316Amostly conserved

340Tmostly conserved

472Cmostly conserved

499Tmostly conserved

535Tmostly conserved

598Tmostly conserved

AACGTTATATATTATTTTTGGTATATGATGTGGACTTTTAGGAACTGGATTAAGGTTGTTAATTCGGTTTGAGCTTGGAACAGCAGGTGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthodoris pinasame genus8.9%Acanthodoris luteasame genus9.9%Acanthodoris nanaimoensissame genus10.1%Acanthodoris atrogriseatasame genus10.5%Acanthodoris brunneasame genus10.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 966 records

Wild obs. + sensor1 868

Museum / vouchered98

Range

Area of Occupancy AOO1 576 km²

Depth

0–200 m sunlit42

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 14 m · max 182.9 m · 42 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 710≤1 km 318≤10 km 53>10 km 360

1 441 georeferenced · 427 without coordinates

Open the mapobservation + sensor1 868

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 4≤1 km 50≤10 km 16>10 km 8

78 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence98

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	42
Santa Barbara Museum of Natural Historylocation not on record	7
Los Angeles, US	2
San Francisco, US	1
Stanford Universitylocation not on record	1

5 institutions · 53 of 98 vouchered records shown · 1 without an institution code

09Environmental DNA8 detections

Where the DNA of Acanthodoris rhodoceras was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys2

Countries1

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

rocky intertidal

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 12.4–21.0

Seasonal swing summer↔winter7.10 °C

Max temp (day)20.9 °C 15.0–25.5

Min temp (night)15.8 °C 10.2–17.9

Precipitation3.20 mm/mo 0.9–92.8

Air humidity64.8 % 63.4–67.6

Moisture balance-38.0 mm/mo

Vapour deficit680 Pa 518–878

Wind speed4.10 m/s

Cloud cover20.6 % 11.7–46.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acanthodoris rhodoceras

At a glance

Sources7 archives

Size & morphology1

Habitat & environment2

Other traits1

At a glance

Record type1 966 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 5 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 966 records