Acanthodoris brunnea

MacFarland, 1905 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Onchidorididae/Acanthodoris

At a glance

Occurrence records126

Data sources8

Biological traits4

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Acanthodoris brunnea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility80 records↗

OBISOcean Biodiversity Information System46 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS126 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

Acanthodoris brunnea, common name the brown horned dorid, is a species of sea slugs, a dorid nudibranch, a shell-less marine gastropod mollusc in the family Onchidorididae.Rosenberg, G. (2015). Acanthodoris brunnea MacFarland, 1905. In: MolluscaBase (2015). Accessed through: World Register of Marine Species on 2016-01-09.Turgeon, D.; Quinn, J.F.; Bogan, A.E.; Coan, E.V.; Hochberg, F.G.; Lyons, W.G.; Mikkelsen, P.M.; Neves, R.J.; Roper, C.F.E.; Rosenberg, G.; Roth, B.; Scheltema, A.; Thompson, F.G.; Vecchione, M.; Williams, J.D. (1998). Common and scientific names of aquatic invertebrates from the United States and Canada: mollusks. 2nd ed. American Fisheries Society Special Publication, 26. American Fisheries Society: Bethesda, MD (USA). . IX, 526 + cd-rom pp.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length1.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Vulnerability10

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthodoris brunnea has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes2

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P680 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.15%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

3Cvariable

GACATTGGAACATTATATATTATTTTTGGTATATGATGTGGACTTTTAGGGACTGGGTTAAGATTATTAATTCGGTTTGAGCTTGGGACA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthodoris luteasame genus7.2%Acanthodoris nanaimoensissame genus7.6%Acanthodoris pinasame genus9.5%Acanthodoris hudsonisame genus10.1%Acanthodoris pilosasame genus10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type126 records

Wild obs. + sensor40

Museum / vouchered85

Other1

Range

Area of Occupancy AOO256 km²

Depth

0–200 m sunlit21

200–1000 m twilight3

1–4 km midnight0

>4 km abyssal0

median 73.5 m · max 420 m · 24 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 11≤1 km 11≤10 km 1

23 georeferenced · 17 without coordinates

Open the mapobservation + sensor40

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 2≤1 km 12≤10 km 24>10 km 14

52 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence85

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	32
Victoria, CA	9
Santa Barbara Museum of Natural Historylocation not on record	4
Philadelphia, US	2
Edmonton, CA	1
Washington, US	1
Los Angeles, US	1

7 institutions · 50 of 85 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Acanthodoris brunnea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.6 °C 20.2–21.0

Seasonal swing summer↔winter7.00 °C

Max temp (day)23.8 °C 22.6–25.0

Min temp (night)18.2 °C 18.0–18.4

Precipitation0.8 mm/mo 0.7–0.9

Air humidity68.1 % 64.3–72.0

Vapour deficit779 Pa 663–894

Cloud cover11.2 % 10.0–12.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)