Acalypta nigrina

(Fallén, 1807) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Tingidae/Acalypta

At a glance

Occurrence records538

Data sources7

Biological traits2

DNA specimens8

eDNA detections64

Sources7 archives

Databases and archives Acalypta nigrina's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility538 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI64 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF538 records

Environmental DNA4 datasets · 6 countries64 detections

DNA & barcodingBOLD8 specimens

01Narrative

De heidemosnetwants is een wants uit de familie van de Tingidae (netwantsen). De soort werd het eerst wetenschappelijk beschreven door Carl Fredrik Fallén in 1807.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acalypta nigrina has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections64

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

1Gmostly conserved

94Tvariable

184Amostly conserved

197Tmostly conserved

206Cmostly conserved

361Cvariable

364Amostly conserved

373Avariable

463Tmostly conserved

495Cmostly conserved

526Tmostly conserved

634Tvariable

643Amostly conserved

GACCCTATACTTTATTTTAGGGGCATGAGCAAGAATATTAGGAACTTCTATAAGATGAATTATCCGAATCGAACTTAGACAACCAGGTCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.76%

Haplotypes3

BIN1

Most divergent pair1.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acalypta marginatasame genus11.1%Acalypta carinatasame genus12.2%Acalypta platycheilasame genus12.8%Acalypta eleganssame genus13.8%Corythucha ciliatasame family16.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type538 records

Wild obs. + sensor182

Museum / vouchered231

Cultivated / captive6

Other119

Range

Area of Occupancy AOO1 400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 93≤1 km 51≤10 km 33

177 georeferenced · 5 without coordinates

Open the mapobservation + sensor182

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 109≤1 km 53≤10 km 24

186 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence231

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Copenhagen, DK	35
Metsähallituslocation not on record	30
SLU Artdatabankenlocation not on record	22
John May Museum of Natural Historylocation not on record	13
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	11
Tartu, EE	11
Bonn, DE	5
Natural History Museum, Aarhus Denmarklocation not on record	4
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	2
NHMOlocation not on record	2
Jyväskylä, FI	2
Trondheim, NO	1
Helsinki, FI	1
CBDClocation not on record	1
ZSMlocation not on record	1
neflocation not on record	1
NCMGlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

18 institutions · 144 of 231 vouchered records shown · 87 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA64 detections

Where the DNA of Acalypta nigrina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found64

Studies independent surveys4

Countries6

Verifiable raw sequence linked49

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 64 detections have coordinates

Open the map6 countries0

4. Native Grassland | 4.1. Tundra4. Native Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 10.4–17.2

Seasonal swing summer↔winter20.8 °C

Max temp (day)19.1 °C 13.1–21.4

Min temp (night)11.5 °C 8.40–13.7

Precipitation76.3 mm/mo 58.0–125

Air humidity59.3 % 58.4–64.0

Moisture balance-33.1 mm/mo -58.4–19.6

Vapour deficit686 Pa 505–813

Wind speed3.20 m/s 2.20–3.80

Cloud cover50.4 % 42.9–56.9

CHELSA 1981–2010, ~9 km grid, at location & month of 64 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)