Corythucha ciliata

(Say, 1832) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Tingidae/Corythucha

At a glance

Occurrence records11 623

Data sources10

Biological traits0

DNA specimens107

eDNA detections92

Sources10 archives

Databases and archives Corythucha ciliata's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 623 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI92 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics107 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF11 623 records

Environmental DNA1 datasets · 7 countries92 detections

DNA & barcodingBOLD107 specimens

Genome at a glanceGoaT · NCBI≈401 Mbp

01Narrative

Bottom (ventral) view Corythucha ciliata, the sycamore lace bug, is a species of lace bug in the family Tingidae that is associated with sycamore trees. It originates in the New World, but has been introduced and has spread in Europe. It is a small, whitish insect and feeds on the underside of the leaves, sucking sap. There are reports in Europe of C. cilata landing on people and biting them. Reports from Italy, France and Romania indicate that some people experience adverse reactions, e.g., dermatosis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding107 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corythucha ciliata has left across the world's sequence archives.

At a glance

DNA specimens107

BINs2

Marker genes12

eDNA detections92

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus85 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

39Tmostly conserved

99Tmostly conserved

180Gvariable

264Amostly conserved

369Gvariable

411Gmostly conserved

627Amostly conserved

645Gvariable

TTATACTTTATATTTGGATTATGAGCAGGAATAGTTGGTACATCTATAAGATGAATTATTCGTATTGAATTAAGACAACCTGGTCCTTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.56%

Haplotypes6

BINs2

Most divergent pair1.4%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Corythucha juglandissame genus4.7%Corythucha padisame genus6.7%Corythucha arcuatasame genus9.2%Corythucha salicatasame genus10.9%Corythucha immaculatasame genus10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_022922 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1l-rRNAs-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Corythucha ciliata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈401 195 523 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Corythucha ciliata0.40 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type11 623 records

Wild obs. + sensor11 025

Museum / vouchered593

Other5

Range

Area of Occupancy AOO18 848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 5 982≤1 km 932≤10 km 1 497>10 km 147

8 558 georeferenced · 2 467 without coordinates

Open the mapobservation + sensor11 025

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 25≤1 km 71≤10 km 144

240 georeferenced · 353 without coordinates

Open the institutions mapphysical evidence593

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NSMKlocation not on record	118
Champaign, US	81
Mississippi State, US	69
Sydney, AU	65
DPIlocation not on record	57
John May Museum of Natural Historylocation not on record	27
Wuzhou, CN	25
Itami Shi, JP	20
South Kensington, GB	5
University of Central Floridalocation not on record	4
Vancouver, CA	3
ZSMlocation not on record	2
Barcelona, ES	2
CUlocation not on record	1
National Institute of Biological Resourceslocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
SOVTlocation not on record	1

18 institutions · 483 of 593 vouchered records shown · 110 without an institution code

09Environmental DNA92 detections

Where the DNA of Corythucha ciliata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found92

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 92 detections have coordinates

Open the map7 countries0

Urban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 15.2–23.0

Seasonal swing summer↔winter19.4 °C

Max temp (day)22.7 °C 19.3–26.9

Min temp (night)14.2 °C 9.60–17.5

Precipitation52.0 mm/mo 47.2–137

Air humidity59.6 % 55.1–60.6

Moisture balance-17.8 mm/mo -42.2–42.2

Vapour deficit894 Pa 683–1,209

Wind speed2.10 m/s 1.30–3.20

Cloud cover38.7 % 26.8–42.9

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Corythucha ciliata

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type11 623 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type11 623 records