Acalypta carinata

(Panzer, 1806) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Tingidae/Acalypta

At a glance

Occurrence records1 181

Data sources7

Biological traits1

DNA specimens16

eDNA detections95

Sources7 archives

Databases and archives Acalypta carinata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 181 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI95 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 181 records

Environmental DNA3 datasets · 5 countries95 detections

DNA & barcodingBOLD16 specimens

01Narrative

De grote mosnetwants is een wants uit de familie van de Tingidae (netwantsen). De soort werd het eerst wetenschappelijk beschreven door Georg Wolfgang Franz Panzer in 1806.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging1

Feeding guild (larval)herbivore

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acalypta carinata has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections95

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

64Cmostly conserved

88Gmostly conserved

131Gmostly conserved

220Tvariable

241Amostly conserved

274Amostly conserved

277Avariable

292Tmostly conserved

310Gmostly conserved

322Amostly conserved

390Cmostly conserved

403Gmostly conserved

532Tmostly conserved

623Gmostly conserved

627Gmostly conserved

628Amostly conserved

630Gmostly conserved

631Amostly conserved

632Gmostly conserved

643Gmostly conserved

AACCTTATACTTTATTTTAGGAATATGAGCAAGAATATTAGGAACCTCAATAAGATGAATTATCCGAATTGAACTTACACAACCAGGGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.68%

Haplotypes6

BIN1

Most divergent pair1.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acalypta platycheilasame genus9.4%Acalypta nigrinasame genus12.2%Acalypta eleganssame genus12.3%Acalypta marginatasame genus13.2%Dictyonota strichnocerasame family16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 181 records

Wild obs. + sensor420

Museum / vouchered600

Cultivated / captive3

Other158

Range

Area of Occupancy AOO2 372 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 168≤1 km 106≤10 km 74>10 km 3

351 georeferenced · 69 without coordinates

Open the mapobservation + sensor420

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 122≤1 km 183≤10 km 198>10 km 9

512 georeferenced · 88 without coordinates

Open the institutions mapphysical evidence600

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum, Aarhus Denmarklocation not on record	160
Copenhagen, DK	86
NHMOlocation not on record	60
SLU Artdatabankenlocation not on record	28
John May Museum of Natural Historylocation not on record	25
Metsähallituslocation not on record	20
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	17
Tromsø, NO	11
Jyväskylä, FI	10
Tartu, EE	7
CBDClocation not on record	5
BioFokuslocation not on record	4
Philadelphia, US	4
Bonn, DE	4
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	3
Trondheim, NO	2
NTNU-VMlocation not on record	2
MZLUlocation not on record	2
Tallinn, EE	1
Helsinki, FI	1
Kuopio, FI	1
ZMAAlocation not on record	1
neflocation not on record	1

23 institutions · 455 of 600 vouchered records shown · 145 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA95 detections

Where the DNA of Acalypta carinata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found95

Studies independent surveys3

Countries5

Verifiable raw sequence linked83

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 95 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 13.2–17.0

Seasonal swing summer↔winter18.3 °C

Max temp (day)20.0 °C 15.7–20.9

Min temp (night)12.4 °C 8.80–13.8

Precipitation97.7 mm/mo 74.8–134

Air humidity60.7 % 58.5–61.8

Moisture balance-23.7 mm/mo -42.9–51.9

Vapour deficit751 Pa 600–776

Wind speed2.80 m/s 2.20–3.70

Cloud cover51.0 % 47.4–58.3

CHELSA 1981–2010, ~9 km grid, at location & month of 94 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acalypta carinata

At a glance

Sources7 archives

Diet & foraging1

At a glance

Record type1 181 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 23 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 181 records