Acalypta platycheila

(Fieber, 1844) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Tingidae/Acalypta

At a glance

Occurrence records243

Data sources6

Biological traits2

DNA specimens6

eDNA detections0

Sources6 archives

Databases and archives Acalypta platycheila's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility243 records↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF243 records

DNA & barcodingBOLD6 specimens

01Narrative

De veenmosnetwants is een wants uit de familie van de Tingidae (Netwantsen). De soort werd het eerst wetenschappelijk beschreven door Franz Xaver Fieber in 1844.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acalypta platycheila has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACCTTATACTTTATTTTAGGTATATGAGCAAGAATATTAGGAACCTCAATAAGATGAATTATCCGAATTGAACTTAGACAACCAGGACC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acalypta carinatasame genus9.4%Acalypta marginatasame genus11.4%Acalypta eleganssame genus11.9%Acalypta nigrinasame genus12.8%Acalypta gracilissame genus15.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type243 records

Wild obs. + sensor31

Museum / vouchered204

Cultivated / captive1

Other7

Range

Area of Occupancy AOO284 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 13≤1 km 4≤10 km 11

28 georeferenced · 3 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 49≤1 km 127≤10 km 5

181 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence204

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
John May Museum of Natural Historylocation not on record	14
Tartu, EE	9
Copenhagen, DK	4
BioFokuslocation not on record	3
CBDClocation not on record	3
NTNU-VMlocation not on record	2
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	1
Philadelphia, US	1
Natural History Museum, Aarhus Denmarklocation not on record	1
NHMOlocation not on record	1
Natural History Museum, Londonlocation not on record	1
South Kensington, GB	1
Jyväskylä, FI	1

13 institutions · 42 of 204 vouchered records shown · 162 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)