Acalypta marginata

(Wolff, 1804) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Tingidae/Acalypta

At a glance

Occurrence records448

Data sources6

Biological traits0

DNA specimens13

eDNA detections8

Sources6 archives

Databases and archives Acalypta marginata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility448 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF448 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD13 specimens

01Narrative

Acalypta marginata is a species of lace bug in the family Tingidae. It is found throughout the Palearctic and in three eastern Asian countries: Japan, Korea and Mongolia. It was originally described in 1804 by Johann Friedrich Wolff. Acalypta marginata seems to prefer drier habitats but has been recorded from a diverse range of habitat types including humid treeless communities, dry grasslands, humid/riverine woodlands and dry forests.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acalypta marginata has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes1

eDNA detections8

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 75 variable positions, in barcode order

1Amostly conserved

5Tmostly conserved

10Tmostly conserved

22Amostly conserved

32Gmostly conserved

43Tmostly conserved

49Cmostly conserved

88Gmostly conserved

92Cmostly conserved

94Amostly conserved

103Cmostly conserved

106Cmostly conserved

112Tvariable

115Tmostly conserved

124Tmostly conserved

133Amostly conserved

151Cmostly conserved

157Cmostly conserved

163Tvariable

178Cmostly conserved

187Cmostly conserved

200Amostly conserved

202Cvariable

205Amostly conserved

206Tmostly conserved

220Amostly conserved

223Tmostly conserved

232Amostly conserved

241Amostly conserved

262Gmostly conserved

263Cmostly conserved

274Amostly conserved

290Tmostly conserved

301Tmostly conserved

305Amostly conserved

306Cmostly conserved

316Gvariable

318Tmostly conserved

325Cmostly conserved

334Cmostly conserved

347Cmostly conserved

349Amostly conserved

361Tmostly conserved

374Tmostly conserved

377Gmostly conserved

385Cmostly conserved

400Amostly conserved

406Cmostly conserved

415Gvariable

416Avariable

428Amostly conserved

433Amostly conserved

457Gmostly conserved

490Gmostly conserved

499Amostly conserved

500Tmostly conserved

505Tmostly conserved

508Gmostly conserved

523Cmostly conserved

547Amostly conserved

550Cmostly conserved

553Amostly conserved

565Tmostly conserved

568Amostly conserved

581Cmostly conserved

586Tmostly conserved

595Cmostly conserved

598Tmostly conserved

604Tmostly conserved

613Cmostly conserved

616Cmostly conserved

619Tmostly conserved

628Tvariable

631Gmostly conserved

643Cmostly conserved

AACCTTATATTTTATTTTAGGAGCATGAGCAGGAATATTAGGTACTTCCATAAGATGAATTATCCGAATCGAACTTAGACAACCAGGGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.7%

Haplotypes3

BINs2

Most divergent pair11.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acalypta nigrinasame genus11.1%Acalypta platycheilasame genus11.4%Acalypta carinatasame genus13.2%Acalypta eleganssame genus13.7%Copium clavicornesame family15.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type448 records

Wild obs. + sensor124

Museum / vouchered228

Cultivated / captive8

Other88

Range

Area of Occupancy AOO868 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 43≤1 km 41≤10 km 18>10 km 1

103 georeferenced · 21 without coordinates

Open the mapobservation + sensor124

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 48≤1 km 105≤10 km 42>10 km 1

196 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence228

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	45
John May Museum of Natural Historylocation not on record	20
SLU Artdatabankenlocation not on record	15
Jyväskylä, FI	7
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	5
Tartu, EE	3
ZSMlocation not on record	2
NTNU-VMlocation not on record	2
Metsähallituslocation not on record	2
TUAlocation not on record	2
National Institute of Biological Resourceslocation not on record	1
Helsinki, FI	1
Philadelphia, US	1
Bonn, DE	1

14 institutions · 107 of 228 vouchered records shown · 121 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Acalypta marginata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.90 °C 1.30–16.0

Seasonal swing summer↔winter21.8 °C

Max temp (day)9.70 °C 3.30–20.1

Min temp (night)0.9 °C -1.70–11.4

Precipitation69.5 mm/mo 31.5–72.4

Air humidity59.3 % 58.3–64.3

Moisture balance-28.8 mm/mo -47.4–11.9

Vapour deficit390 Pa 246–744

Wind speed3.40 m/s 2.90–4.20

Cloud cover43.3 % 31.9–55.3

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)