Abia nitens

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Cimbicidae/Abia

At a glance

Occurrence records1 118

Data sources6

Biological traits0

DNA specimens14

eDNA detections23

Sources6 archives

Databases and archives Abia nitens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 118 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 118 records

Environmental DNA1 datasets · 6 countries23 detections

DNA & barcodingBOLD14 specimens

01Narrative

Abia nitens is een vliesvleugelig insect uit de familie van de knotssprietbladwespen (Cimbicidae). De wetenschappelijke naam is gepubliceerd in 1758 door Linnaeus in de tiende editie van Systema naturae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abia nitens has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections23

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 66 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

11Tmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Amostly conserved

24Tmostly conserved

25Tmostly conserved

27Gmostly conserved

29Tmostly conserved

30Cmostly conserved

32Gmostly conserved

33Gmostly conserved

37Amostly conserved

38Amostly conserved

39Tmostly conserved

40Tmostly conserved

41Gmostly conserved

42Gmostly conserved

44Amostly conserved

45Tmostly conserved

46Amostly conserved

48Cmostly conserved

50Tmostly conserved

51Tmostly conserved

54Gmostly conserved

55Tmostly conserved

58Amostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Amostly conserved

69Cmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

80Amostly conserved

84Cmostly conserved

86Gmostly conserved

87Gmostly conserved

90Cmostly conserved

92Tmostly conserved

94Amostly conserved

95Amostly conserved

96Tmostly conserved

97Tmostly conserved

99Gmostly conserved

100Amostly conserved

103Tmostly conserved

310Tmostly conserved

391Cvariable

437Gmostly conserved

541Gvariable

625Gvariable

AACATTATATTTTATTTTTGGATTTTGATCAGGAATAATTGGAATATCTTTTAGTATAATTATTCGAACAGAATTAGGAACAGCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.1%

Haplotypes3

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abia candenssame genus5.0%Abia fulgenssame genus6.5%Abia fasciatasame genus10.7%Abia aeneasame genus10.7%Abia americanasame genus11.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 118 records

Wild obs. + sensor1 029

Museum / vouchered89

Range

Area of Occupancy AOO3 308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 642≤1 km 178≤10 km 85>10 km 18

923 georeferenced · 106 without coordinates

Open the mapobservation + sensor1 029

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 3≤1 km 32≤10 km 18>10 km 2

55 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence89

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	29
Muzeum Górnośląskie w Bytomiulocation not on record	20
Zürich, CH	10
NCMGlocation not on record	5
Institute of Zoology Slovak Academy of Scienceslocation not on record	3
Helsinki, FI	3
South Kensington, GB	3
Oulu, FI	2
Bavarian State Collection of Zoologylocation not on record	1

9 institutions · 76 of 89 vouchered records shown · 13 without an institution code

09Environmental DNA23 detections

Where the DNA of Abia nitens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 11.0–19.0

Seasonal swing summer↔winter17.9 °C

Max temp (day)20.0 °C 13.9–23.4

Min temp (night)11.1 °C 6.50–14.2

Precipitation73.0 mm/mo 56.5–120

Air humidity59.0 % 57.4–62.9

Moisture balance-40.2 mm/mo -62.7–5.40

Vapour deficit727 Pa 491–932

Wind speed3.30 m/s 2.40–4.50

Cloud cover37.7 % 31.4–45.6

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Abia nitens

At a glance

Sources6 archives

At a glance

Record type1 118 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 118 records