Abia aenea

(Klug, 1820) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Cimbicidae/Abia

At a glance

Occurrence records588

Data sources8

Biological traits0

DNA specimens36

eDNA detections33

Sources8 archives

Databases and archives Abia aenea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility588 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF588 records

Environmental DNA1 datasets · 8 countries33 detections

DNA & barcodingBOLD36 specimens

Genome at a glanceGoaT · NCBI≈189 Mbp

01Narrative

Abia aenea is een vliesvleugelig insect uit de familie van de knotssprietbladwespen (Cimbicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1829 door Klug.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abia aenea has left across the world's sequence archives.

At a glance

DNA specimens36

BINs3

Marker genes1

eDNA detections33

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P650 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

97Amostly conserved

130Tmostly conserved

344Cmostly conserved

350Amostly conserved

358Amostly conserved

410Amostly conserved

422Tmostly conserved

427Gmostly conserved

478Gmostly conserved

547Cmostly conserved

572Cmostly conserved

580Tmostly conserved

610Tmostly conserved

619Amostly conserved

625Tmostly conserved

628Tmostly conserved

ATTATATTTTATTTTCGGATTCTGATCAGGAATAATTGGATTATCATTTAGTATAATTATTCGAACTGAATTAGGAACTTCAGGATCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.71%

Haplotypes4

BINs2

Most divergent pair2.5%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abia americanasame genus7.8%Abia candenssame genus10.0%Abia sericeasame genus10.4%Abia fulgenssame genus10.6%Abia nitenssame genus10.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Abia aenea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈188 743 821 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Abia aenea0.19 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.9% BUSCO

08Occurrence & distribution

Record type588 records

Wild obs. + sensor382

Museum / vouchered206

Range

Area of Occupancy AOO1 428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy30% within 1 km

≤100 m 66≤1 km 44≤10 km 251

361 georeferenced · 21 without coordinates

Open the mapobservation + sensor382

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 18≤1 km 19≤10 km 127

164 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence206

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	96
NHMOlocation not on record	14
ZSMlocation not on record	10
Oulu, FI	10
Provincia di Livornolocation not on record	9
Zürich, CH	9
Tilburg, NL	6
SLU Artdatabankenlocation not on record	6
Bavarian State Collection of Zoologylocation not on record	4
BioFokuslocation not on record	3
Gothenburg, SE	1
NEFlocation not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
MZLUlocation not on record	1
South Kensington, GB	1
neflocation not on record	1

16 institutions · 173 of 206 vouchered records shown · 33 without an institution code

09Environmental DNA33 detections

Where the DNA of Abia aenea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map8 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 6.50–14.7

Seasonal swing summer↔winter24.5 °C

Max temp (day)16.8 °C 11.1–18.2

Min temp (night)8.10 °C 0.8–11.0

Precipitation73.2 mm/mo 43.6–98.0

Air humidity58.6 % 56.6–61.3

Moisture balance-35.4 mm/mo -49.0–12.7

Vapour deficit601 Pa 422–699

Wind speed2.50 m/s 2.20–4.50

Cloud cover45.1 % 33.4–51.9

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)