Abia fulgens

Zaddach, 1863 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Cimbicidae/Abia

At a glance

Occurrence records400

Data sources6

Biological traits0

DNA specimens16

eDNA detections16

Sources6 archives

Databases and archives Abia fulgens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility400 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF400 records

Environmental DNA1 datasets · 5 countries16 detections

DNA & barcodingBOLD16 specimens

01Narrative

Abia fulgens is een vliesvleugelig insect uit de familie van de knotssprietbladwespen (Cimbicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1863 door Zaddach.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abia fulgens has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections16

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 69 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

5Cmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

10Tmostly conserved

11Tmostly conserved

13Cmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Amostly conserved

24Tmostly conserved

25Tmostly conserved

27Gmostly conserved

29Tmostly conserved

30Cmostly conserved

32Gmostly conserved

33Gmostly conserved

37Amostly conserved

38Amostly conserved

39Tmostly conserved

40Tmostly conserved

41Gmostly conserved

42Gmostly conserved

44Amostly conserved

45Tmostly conserved

48Cmostly conserved

49Amostly conserved

50Tmostly conserved

51Tmostly conserved

52Tmostly conserved

54Gmostly conserved

58Amostly conserved

61Tvariable

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Amostly conserved

69Cmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

80Amostly conserved

84Cmostly conserved

85Amostly conserved

86Gmostly conserved

87Gmostly conserved

88Tmostly conserved

90Cmostly conserved

92Tmostly conserved

94Amostly conserved

95Amostly conserved

96Tmostly conserved

97Tmostly conserved

99Gmostly conserved

100Amostly conserved

232Cmostly conserved

271Cmostly conserved

460Tmostly conserved

AACACTATATTTCATTTTTGGATTTTGATCAGGAATAATTGGAATATCATTTAGAATAATTATTCGAACAGAATTAGGAACAGCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes3

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abia candenssame genus5.3%Abia sericeasame genus6.2%Abia nitenssame genus6.5%Abia aeneasame genus10.6%Trichiosoma sibiricumsame family11.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type400 records

Wild obs. + sensor328

Museum / vouchered70

Other2

Range

Area of Occupancy AOO768 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 49≤1 km 190≤10 km 29

268 georeferenced · 60 without coordinates

Open the mapobservation + sensor328

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤1 km 25≤10 km 16

41 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence70

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	23
Zürich, CH	17
Muzeum Górnośląskie w Bytomiulocation not on record	11
ZSMlocation not on record	8
Bavarian State Collection of Zoologylocation not on record	1

5 institutions · 60 of 70 vouchered records shown · 10 without an institution code

09Environmental DNA16 detections

Where the DNA of Abia fulgens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.9 °C 5.20–17.6

Seasonal swing summer↔winter19.3 °C

Max temp (day)18.1 °C 9.30–22.0

Min temp (night)8.50 °C -0.7–12.0

Precipitation197 mm/mo 107–340

Air humidity62.3 % 60.7–65.1

Moisture balance71.4 mm/mo -12.8–221

Vapour deficit574 Pa 337–779

Wind speed2.90 m/s 1.10–7.30

Cloud cover36.9 % 35.0–38.1

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)