Abia americana

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Cimbicidae/Abia

At a glance

Occurrence records227

Data sources5

Biological traits0

DNA specimens51

eDNA detections45

Sources5 archives

Databases and archives Abia americana's data was compiled from.

GBIFGlobal Biodiversity Information Facility227 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics51 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF227 records

Environmental DNA1 datasets · 2 countries45 detections

DNA & barcodingBOLD51 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding51 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abia americana has left across the world's sequence archives.

At a glance

DNA specimens51

BINs5

Marker genes1

eDNA detections45

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P650 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

61Cmostly conserved

85Gvariable

160Amostly conserved

178Amostly conserved

181Cmostly conserved

214Amostly conserved

232Tmostly conserved

334Gvariable

337Tvariable

367Gmostly conserved

391Cmostly conserved

400Cmostly conserved

422Cmostly conserved

427Amostly conserved

449Amostly conserved

493Amostly conserved

542Tmostly conserved

559Amostly conserved

562Amostly conserved

607Tmostly conserved

613Cmostly conserved

619Amostly conserved

622Amostly conserved

625Gvariable

640Tmostly conserved

646Tmostly conserved

ATTATACTTTATCTTTGGATTCTGATCAGGAATAATCGGATTATCATTTAGTATAATTATCCGAACAGAATTAGGAACTTCAGGGTCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes8

BINs2

Most divergent pair3.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abia aeneasame genus7.8%Abia candenssame genus10.7%Abia fulgenssame genus11.2%Abia fasciatasame genus11.4%Abia sericeasame genus11.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type227 records

Wild obs. + sensor153

Museum / vouchered74

Range

Area of Occupancy AOO700 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 79≤1 km 21≤10 km 5>10 km 6

111 georeferenced · 42 without coordinates

Open the mapobservation + sensor153

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 6

6 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence74

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	26
University of Guelph, Centre for Biodiversity Genomicslocation not on record	13
Royal Saskatchewan Museumlocation not on record	9
Edmonton, CA	6

4 institutions · 54 of 74 vouchered records shown · 20 without an institution code

09Environmental DNA45 detections

Where the DNA of Abia americana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map2 countries0

1. Forest & Woodland | 1.4. Temperate Forest1. Forest & Woodland|1.1. Boreal ForestAgricultural field4. Native Grassland | 4.4. Temperate Grassland1. Forest | 1.4. Forest - TemperateRiparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 8.60–17.8

Seasonal swing summer↔winter25.8 °C

Max temp (day)18.9 °C 14.3–23.8

Min temp (night)8.40 °C 2.10–12.5

Precipitation71.6 mm/mo 45.4–107

Air humidity55.9 % 50.8–58.7

Moisture balance-52.2 mm/mo -89.6–-15.7

Vapour deficit682 Pa 483–907

Wind speed2.70 m/s 2.00–3.90

Cloud cover39.8 % 32.9–46.5

CHELSA 1981–2010, ~9 km grid, at location & month of 43 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)