Abia fasciata

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Cimbicidae/Abia

At a glance

Occurrence records2 511

Data sources6

Biological traits0

DNA specimens43

eDNA detections37

Sources6 archives

Databases and archives Abia fasciata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 511 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics43 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 511 records

Environmental DNA2 datasets · 5 countries37 detections

DNA & barcodingBOLD43 specimens

01Narrative

De kamperfoeliebladwesp is een vliesvleugelig insect uit de familie van de knotssprietbladwespen (Cimbicidae). De wetenschappelijke naam van de soort is gepubliceerd in 1758 door Linnaeus in de tiende editie van Systema naturae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding43 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abia fasciata has left across the world's sequence archives.

At a glance

DNA specimens43

BINs1

Marker genes1

eDNA detections37

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P650 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

181Avariable

214Amostly conserved

268Avariable

328Amostly conserved

367Amostly conserved

586Tmostly conserved

TTTATACTTCATTTTCGGATTTTGATCAGGAATAATCGGTTTATCATTTAGAATAATTATTCGAACTGAATTAGGAACTCCAGGATCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.27%

Haplotypes5

BIN1

Most divergent pair0.62%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abia aeneasame genus10.0%Abia sericeasame genus10.4%Abia nitenssame genus10.7%Abia candenssame genus11.3%Trichiosoma sibiricumsame family12.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 511 records

Wild obs. + sensor2 119

Museum / vouchered392

Range

Area of Occupancy AOO6 436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 772≤1 km 250≤10 km 829>10 km 25

1 876 georeferenced · 243 without coordinates

Open the mapobservation + sensor2 119

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 66≤1 km 83≤10 km 154>10 km 2

305 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence392

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ZMAAlocation not on record	69
Zürich, CH	40
Provincia di Livornolocation not on record	36
NHMOlocation not on record	33
SLU Artdatabankenlocation not on record	18
Tilburg, NL	17
Oulu, FI	15
Muzeum Górnośląskie w Bytomiulocation not on record	13
ZSMlocation not on record	13
Philadelphia, US	8
Bavarian State Collection of Zoologylocation not on record	5
Gothenburg, SE	5
BioFokuslocation not on record	5
MZLUlocation not on record	4
Natural History Museum Rotterdamlocation not on record	4
Tartu, EE	3
Bonn, DE	3
Helsinki, FI	2
neflocation not on record	2
Rovaniemi, FI	2
NEFlocation not on record	2
NCMGlocation not on record	2
Stockholm, SE	1
Salzburg, AT	1
Metsähallituslocation not on record	1
CBDClocation not on record	1
Champaign, US	1
Natural History Museum, Londonlocation not on record	1
South Kensington, GB	1
NTNU-VMlocation not on record	1

30 institutions · 309 of 392 vouchered records shown · 83 without an institution code

09Environmental DNA37 detections

Where the DNA of Abia fasciata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys2

Countries5

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map5 countries0

Eldre, rik lagurt-blandingsskog i vestvendt …

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 10.1–18.2

Seasonal swing summer↔winter22.9 °C

Max temp (day)17.2 °C 14.5–22.5

Min temp (night)11.0 °C 5.50–13.6

Precipitation84.5 mm/mo 60.6–122

Air humidity58.6 % 57.2–60.7

Moisture balance-30.6 mm/mo -50.8–14.6

Vapour deficit687 Pa 543–873

Wind speed2.60 m/s 2.00–4.10

Cloud cover43.8 % 33.3–57.1

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Abia fasciata

At a glance

Sources6 archives

At a glance

Record type2 511 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 511 records