Trypeta zoe

Meigen, 1826 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tephritidae/Trypeta

At a glance

Occurrence records658

Data sources7

Biological traits2

DNA specimens18

eDNA detections16

Sources7 archives

Databases and archives Trypeta zoe's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility658 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF658 records

Environmental DNA2 datasets · 5 countries16 detections

DNA & barcodingBOLD18 specimens

01Narrative

Trypeta zoe, the daisy leafminer, is a species of tephritid or fruit flies in the genus Trypeta of the family Tephritidae.Nomen.at - animals and plantsGlobal Biodiversity Information Facility Foodplants include Achillea species, Artemisia vulgaris, Artemisia absinthium and Leucanthemum vulgare, where larvae form leaf mines. This species is present in Austria, Belgium, Bulgaria, Croatia, Czech Republic, Denmark, Finland, France, Germany, Great Britain, Hungary, Ireland, Italy, Norway, Poland, Romania, Slovakia, Spain, Sweden, Switzerland and Netherlands.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trypeta zoe has left across the world's sequence archives.

At a glance

DNA specimens18

BINs3

Marker genes1

eDNA detections16

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 60 variable positions, in barcode order

4Tmostly conserved

22Tmostly conserved

43Gmostly conserved

49Tmostly conserved

59Tmostly conserved

103Tmostly conserved

106Cmostly conserved

133Tmostly conserved

190Tmostly conserved

202Avariable

205Tmostly conserved

212Cmostly conserved

232Amostly conserved

235Tmostly conserved

238Tmostly conserved

244Gmostly conserved

271Amostly conserved

277Tmostly conserved

283Cmostly conserved

289Amostly conserved

307Gmostly conserved

316Amostly conserved

328Tmostly conserved

340Tmostly conserved

346Amostly conserved

347Tmostly conserved

357Tmostly conserved

358Tmostly conserved

364Tmostly conserved

373Avariable

382Tmostly conserved

415Amostly conserved

416Amostly conserved

418Tmostly conserved

433Gmostly conserved

436Amostly conserved

439Tmostly conserved

451Amostly conserved

457Avariable

466Amostly conserved

478Tmostly conserved

482Amostly conserved

490Cmostly conserved

517Tmostly conserved

520Tmostly conserved

526Cmostly conserved

533Tmostly conserved

539Cmostly conserved

541Amostly conserved

542Cmostly conserved

553Tmostly conserved

578Tmostly conserved

586Tmostly conserved

607Amostly conserved

619Cmostly conserved

628Amostly conserved

631Gvariable

640Tmostly conserved

641Tmostly conserved

646Cmostly conserved

AACTTTATATTTTATTTTCGGTGCTTGAGCTGGAATAGTAGGGACATCTCTTAGTATTTTAATTCGAGCTGAATTAGGTCATCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes5

BINs3

Most divergent pair0.76%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Trypeta flaveolasame genus4.1%Trypeta immaculatasame genus6.3%Euleia heracleisame family7.1%Trypeta artemisiaesame genus7.1%Euleia uncinatasame family7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type658 records

Wild obs. + sensor467

Museum / vouchered191

Range

Area of Occupancy AOO1 704 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 180≤1 km 74≤10 km 178>10 km 5

437 georeferenced · 30 without coordinates

Open the mapobservation + sensor467

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 32≤1 km 30≤10 km 48>10 km 1

111 georeferenced · 80 without coordinates

Open the institutions mapphysical evidence191

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	46
MZLUlocation not on record	28
Helsinki, FI	24
SLU Artdatabankenlocation not on record	21
South Kensington, GB	17
Stockholm, SE	10
Natural History Museum Rotterdamlocation not on record	8
Tilburg, NL	7
University of Tokyo, Department of Zoologylocation not on record	4
DFlocation not on record	3
CBDClocation not on record	2
NHMOlocation not on record	2
Philadelphia, US	1
Gothenburg, SE	1
Natural History Museum, Londonlocation not on record	1
neflocation not on record	1
Copenhagen, DK	1

17 institutions · 177 of 191 vouchered records shown · 14 without an institution code

09Environmental DNA16 detections

Where the DNA of Trypeta zoe was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys2

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map5 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.3 °C 6.40–15.7

Seasonal swing summer↔winter16.0 °C

Max temp (day)18.0 °C 10.7–19.8

Min temp (night)10.3 °C 0.7–12.4

Precipitation76.0 mm/mo 57.3–263

Air humidity60.5 % 59.2–64.6

Moisture balance-17.4 mm/mo -54.1–167

Vapour deficit627 Pa 345–710

Wind speed3.70 m/s 3.00–6.50

Cloud cover39.2 % 35.7–43.0

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)